PPT-Detecting selection using genome scans

Author : ellena-manuel | Published Date : 2016-11-14

Roger Butlin University of Sheffield Nielsen R 2005 Molecular signatures of natural selection Annu Rev Genet 39 197218 What signatures does selection leave

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "Detecting selection using genome scans" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

Detecting selection using genome scans: Transcript


Roger Butlin University of Sheffield Nielsen R 2005 Molecular signatures of natural selection Annu Rev Genet 39 197218 What signatures does selection leave in the genome Population differentiation todays focus. 4 Bloody Obvious Scans Scans 6 A Hypothesis We see two populations: •Normal users, who know where they’re going •Attackers, primarily scanners, who have no idea about the network’s Credits to Vanessa Patel for some of the slides. The Hominid Lineage. Archaeology – “the scientific study of material remains (as fossil relics, artifacts, and monuments) of past human life and activities. integrated encyclopedia of DNA elements in the human . genome”. ENCODE Project Consortium. . Nature . 2012 Sep 6; 489:57-74.. Michael . M. Hoffman. University of Washington. 12 September 2012. Major results. On the immortality of television sets: “function” in the human genome according to the evolution-free gospel of ENCODE. AKA:. why the ENCODE . project is full of it. by Matthew . Oberhardt. What is ENCODE?. -galactoside) and the subsequent blue staining of the host colonyor bacteriophage plaque expressing the carboxyterminal portion ofthe b Blue/white color screening is well established as a meansfor ide Introduction: Human Population Genomics. ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG. Cost. Killer apps. Roadblocks?. How soon will we all be sequenced?. Time. 2013?. 2018?. Cost. Applications. Detecting Variation. In populations or when comparing closely related species, one major objective is to identify variation among the samples. AKA, one of the main goals in genomics is to identify what genomic features make individuals/populations/species different. Joel T. Nelson, . Damilola. . Olabode. , Shawn . Trojhan. Amazonian tree that has been cultivated for the production of cocoa . Originally, two main genetic clusters. Criollo and . Forastero. . Poor agronomic performance and high susceptibility to diseases, hybridization between Criollo and . Jamie . Winternitz. Institute of Botany and Vertebrate Biology, Czech Academy of Sciences. Outline of talk. The Chimp and the River. Negative-frequency dependent selection. Phylogenetic methods. The Island Fox. livestock. Dr Indrasen Chauhan. Scientist, CSWRI, Avikanagar. Tonk-304501. – . B. ased . on individual records, pedigree or progeny performance or family performance. . SI=WT9 +1DMY90. Conventional selection . Lesson . 9_1: . Evolutionary signatures of . function. Hardison . BMMB 551. 3/29/15. 1. Changes in genome sequence. 3/29/15. 2. Types of sequence change in DNA. CRM = . cis. -regulatory module, e.g. promoter or enhancer. at odds with the most “sacred cow” of modern academia. Among other things, it might even result in my expulsion from the academic world.’ I know John personally and treasure his Century: Mendelian Principles are extended and the Chromosomal Theory of Except for his early adult years, Mendel e research program. who had performed similar experiments to his, arrived at the sa ��7=H�!,D!(V!"&)"(/!@��?!MX!7;HH�E�UC�E!KX!;DD&#x 0.5;&#x 000;8U;==!MX!7&#x 0.5;&#x 000;US&#x 0.5;&#x 000;!JX!OLIC9&#x 0.5;&#x 000;HH!MX!&#x 0.5

Download Document

Here is the link to download the presentation.
"Detecting selection using genome scans"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents