PPT-Why and how to test for germline

BRCA mutations in Pancreatic Cancer ESDO Learning Bytes December 2021 Alica Katrin Beutel Department of Internal Medicine I University Hospital Ulm Germany BRCA BReast CAncer Susceptibility Genes. Of Which People, By Which People, For Which People?. Charis Thompson. Chancellor’s Professor . UC Berkeley / London School . of Economics. Washington, DC, December 2015. Consensus on Human . Germline. ▽. tggttgtttccaccttttgg. atgcatagtcacctttttga. ▲. gtagcttttgtatgttaggc. …981Ns…. g. aggagcagtgcttccacac. ▲. tctgaggcggaacatggtggcgcctttctttgcaggggtggctatgtagaga. ▽. agttgtcctggacacttcca. atgtatcataatttatctcttcacctcctgtagggcatct. Ben Ho Park MD PhD. Johns Hopkins University. Financial Disclosures. I have financial relationships with commercial entities that are relevant to the content of this presentation.. Royalties from Horizon Discovery, LTD. Kyle Orwig. Magee-. Womens. Research Institute. University of Pittsburgh School of Medicine. International Summit on Human Gene Editing:. A Global Discussion. December 1-3, 2015. Stem Cell. Renewal. HEVA screen is a kit for the analysis of the ATM, APC, BARD 1 , BRCA 1 , BRCA 2 , BRIP 1 , CDH 1 , CHEK 2 , EPCAM, MLH 1 , MSH 2 , MSH 6 , MUTYH, NBN, PALB 2 , PMS 2 , PTEN, RAD 50 , RAD 51 C, RAD 51 Dr Fiona McRonald 11. th. June 2019. NCRAS, Public Health England. National Disease Registration Service (NDRS). 2. NAACCR-IACR, Vancouver, 2019. National Cancer Registration and Analysis Service (NCRAS). Dr Katie Snape. Joint Lead Consultant for Cancer Genetics,. South West Thames Regional Genetics Service. St George’s University Hospitals NHS Foundation Trust. Approval ID: GB-17285. Date of Preparation: June 2019. We performed a genome-wide analysis of gene expressionto identify germline- and sex-regulated genes.Using mutants that cause defects in germ cell proliferationor gametogenesis, we identiÞed sets of g CancerGenetics@utsouthwestern.edu | 214 - 645 - 2563 Somatic and Germline Genetic Testing Somatic Testing Most cancer is the result of acquired, or somatic , mutations that occur in a cell. Cancers ICH Considerations General Principles to Address the Risk of Inadvertent Germline Integration of Gene Therapy Vectors TRANSMISSION TO CHMP November 2006 RELEASED FOR INFORMATION November 2006 Laura Yarram-Smith . Solid Tumour Lead SWGLH. July 2023. https://www.nbt.nhs.uk/south-west-genomic-laboratory-hub. Part of a Genomic Medicine Service. Bristol Clinical Genetics . Peninsula Clinical Genetics. FRCPath. MFPH MSc (Epidemiology). Professor in Translational Cancer Genetics. , Institute of Cancer Research. NHS Consultant in Clinical Genetics . (Honorary), Royal Marsden NHS Foundation Trust. Consultant in Public Health Medicine . WGA AML. WGA AML. Skin. Skin. WGA GCT. WGA GCT. FANCA . g.. 89833576G>C . testing . pathways. Format. Round table discussion . 5 working groups . –. Breast, Colorectal, Ovarian, Other, TP53. Three documents on table. Individual variant testing scoring form (all to complete).