DOC
SLIDES
Featured
Recent
Articles
Topics
Upload
Login
Sign Up
Featured
Recent
Articles
Topics
Upload
Login
Sign Up
Home
›
Search Results for "germline"
Search Results for 'germline'
germline published presentations and documents on DocSlides.
Gene Therapy In and Around the Germline
by trish-goza
Kyle Orwig. Magee-. Womens. Research Institute. ...
Genomic/Genetic Testing Germline v Somatic testing and the importance of Molecular Tumor Boards
by lois-ondreau
Ben Ho Park MD PhD. Johns Hopkins University. Fin...
Breakout session 1 Somatic-to-germline
by unita
testing . pathways. Format. Round table discussion...
Governance, Regulation, and Control:
by celsa-spraggs
Of Which People, By Which People, For Which Peopl...
Genetic testing in ovarian cancer
by BlueEyedBeauty
Dr Katie Snape. Joint Lead Consultant for Cancer G...
IntroductionKnowledge of spatial and temporal gene expression proles
by delilah
We performed a genome-wide analysis of gene expres...
UTSW Cancer Genetics
by taylor
CancerGenetics@utsouthwestern.edu | 214 - 645 - 25...
European Medicines Agency 7 Westferry Circus Canary Wharf London E1
by bery
ICH Considerations General Principles to Address...
Why and how to test for germline
by isabella2
BRCA. mutations in Pancreatic Cancer. ESDO Learni...
Breakout session 1 Somatic-to-germline testing
by natalia-silvester
Breakout session 1 Somatic-to-germline testing pat...
Haem Genomics update Chris Wragg, Haematological Cancer Lead Scientist,
by ethlyn
South West Genomic Laboratory Hub. 23. rd. Februa...
Prudence in Germline Gene Editing
by rose
The Urgent Need for Collaborative Partnerships in ...
Genomic Prostate Cancer Testing for Olaparib
by abigail
Laura Yarram-Smith . Solid Tumour Lead SWGLH. J...
Hans-Willem Snoeck , Chair of the Columbia University Human Embryonic and Human Pluripotent Stem
by genevieve
Deborah Stiles, Vice President for Research Operat...
proteins that can be engineered to induce a doublestrand break in a s
by obrien
in animals such as rats the precise effects of gen...
Hereditary syndromes, genetic testing and
by Kingslayer
gynaecological. cancers. Prof.. Nicoletta . Col...
Cancer Registration in the Era of Genomics: Integrating Germline and Somatic Genetic Data into the
by SoulfulDreamer
Dr Fiona McRonald 11. th. June 2019. N...
Clinical Benefit of Integrative Genomic Profiling
by ava
in Advanced Solid Tumors. EDRN Biomarker Developme...
Prudence in Germline Gene Editing The Urgent Need
by yoshiko-marsland
Prudence in Germline Gene Editing The Urgent Need ...
Supplementary Fig . 1 (a)
by hadly
Phenotypic characteristics of caprine male germlin...
https://www.chemistryworld.com/news/study-claiming-gene-edited-babies-were-more-likely-to-die-young
by violet
Ethics, governance and policy aspects of human gen...
Clare Turnbull, PhD FRCP
by ash
FRCPath. MFPH MSc (Epidemiology). Professor in Tr...
“Mainstream” Genetic Consultation
by ida
Patient meets eligibility criteria as per . Nation...
Clinical interpretation of genomic variants
by trinity
Harriet Feilotter, PhD, FCCMG, FACMG. Professor, D...
Readiness level of
by finley
the. . Brazilian. . regulatory. framework: . ca...
A Comprehensive Review of p53 Mutations and Cancer Incidence in Companion Animals
by mary
Presented by: . Amit Levi. Class of 2022. Mentor:....
Supplemental Figure 2: Sanger Trace of Putative Germline FANCA S858R Variant
by ava
WGA AML. WGA AML. Skin. Skin. WGA GCT. WGA GCT. FA...
Screening of Genetic Variants in Familial Case of Myeloid Neoplasm Using Exome Sequencing
by edolie
State University of Campinas (UNICAMP). School of ...
National Childhood Cancer Registry
by walter434
Long Term Outcomes of Children and Young Adults wi...
The genomics facilitator’s toolkit NTGLH_004 Whole
by tawny-fly
The genomics facilitator’s toolkit NTGLH_004 Who...
Case Discussion: Second
by celsa-spraggs
Opinion. 55 year-old woman with . recurrent . ova...
U nknown genetic predisposition
by lois-ondreau
in familial breast cancer . . can . lie deep in ...
Division and
by lindy-dunigan
Differentiation . in . Human . C. ells. Writing i...
U nknown genetic predisposition
by tatyana-admore
in familial breast cancer . . can . lie deep in ...
tcacctcctgtagggcatct
by tawny-fly
â–˝. tggttgtttccaccttttgg. atgcatagtcacctttttga. ...
Nathan Krohne
by lois-ondreau
Color Blindness. Discovery. John Dalton, an Engli...
Experimental Medicine Trials of Promising HIV Candidates
by phoebe-click
Robin Shattock. . Experimental . Medicine . Tria...
Human Germline Cycle
by faustina-dinatale
Specification . of Primordial Germ Cells. (PGCs) ...
State of the Art in BRCA
by ellena-manuel
-Mutated Ovarian Cancer. This program will includ...
ASHG Workshop Classifying and Interpreting Germline and Somatic Variants in Your Large Cohort Stud
by tatyana-admore
Karchin Lab. Department of Biomedical Engineering...
Load More...