Search Results for 'germline'

germline published presentations and documents on DocSlides.

Gene Therapy In and Around the Germline
Gene Therapy In and Around the Germline
by trish-goza
Kyle Orwig. Magee-. Womens. Research Institute. ...
Breakout session 1 Somatic-to-germline
Breakout session 1 Somatic-to-germline
by unita
testing . pathways. Format. Round table discussion...
Genomic/Genetic Testing Germline v Somatic testing and the importance of Molecular Tumor Boards
Genomic/Genetic Testing Germline v Somatic testing and the importance of Molecular Tumor Boards
by lois-ondreau
Ben Ho Park MD PhD. Johns Hopkins University. Fin...
Why and how to test for germline
Why and how to test for germline
by isabella2
BRCA. mutations in Pancreatic Cancer. ESDO Learni...
European Medicines Agency 7 Westferry Circus Canary Wharf London E1
European Medicines Agency 7 Westferry Circus Canary Wharf London E1
by bery
ICH Considerations General Principles to Address...
UTSW Cancer Genetics
UTSW Cancer Genetics
by taylor
CancerGenetics@utsouthwestern.edu | 214 - 645 - 25...
IntroductionKnowledge of spatial and temporal gene expression proles
IntroductionKnowledge of spatial and temporal gene expression proles
by delilah
We performed a genome-wide analysis of gene expres...
Genetic testing in ovarian cancer
Genetic testing in ovarian cancer
by BlueEyedBeauty
Dr Katie Snape. Joint Lead Consultant for Cancer G...
Governance, Regulation, and Control:
Governance, Regulation, and Control:
by celsa-spraggs
Of Which People, By Which People, For Which Peopl...
Case Discussion: Second
Case Discussion: Second
by celsa-spraggs
Opinion. 55 year-old woman with . recurrent . ova...
Editorial governance in
Editorial governance in
by mitsue-stanley
germline. gene editing. Philip Campbell. Editor-...
The French Perspective The
The French Perspective The
by sherrill-nordquist
law. 1994. Civil code: . Art. 16-4. . <<. ...
Why ?   And what are the current alternatives ?
Why ? And what are the current alternatives ?
by natalia-silvester
The Francis Crick Institute, London, UK. Moderato...
 Patient Selection for PARP
Patient Selection for PARP
by sherrill-nordquist
Inhibitors:. Purpose and Practicalities . Present...
Please note, these are the actual video-recorded
Please note, these are the actual video-recorded
by blindnessinfluenced
proceedings from the live CME event and may includ...
MIWI and MILI find small partnersTwo independent reports reveal the ex
MIWI and MILI find small partnersTwo independent reports reveal the ex
by jones
DOI:10.1038/nrg1908URLs RNA WORLD ORIGINAL RESEARC...
molecular
molecular
by miller
HEVA screen is a kit for the analysis of the ATM, ...
Prudence in Germline Gene Editing The Urgent Need
Prudence in Germline Gene Editing The Urgent Need
by yoshiko-marsland
Prudence in Germline Gene Editing The Urgent Need ...
Genomic Testing: When and Why?
Genomic Testing: When and Why?
by callie
Rob Finch, MS, CGC. Certified Genetic Counselor. M...
ASHG  Workshop Classifying and Interpreting Germline and Somatic Variants in Your Large Cohort Stud
ASHG Workshop Classifying and Interpreting Germline and Somatic Variants in Your Large Cohort Stud
by tatyana-admore
Karchin Lab. Department of Biomedical Engineering...
State of the Art in  BRCA
State of the Art in BRCA
by ellena-manuel
-Mutated Ovarian Cancer. This program will includ...
Human  Germline  Cycle
Human Germline Cycle
by faustina-dinatale
Specification . of Primordial Germ Cells. (PGCs) ...
Experimental Medicine Trials of Promising HIV Candidates
Experimental Medicine Trials of Promising HIV Candidates
by phoebe-click
Robin Shattock. . Experimental . Medicine . Tria...
Nathan Krohne
Nathan Krohne
by lois-ondreau
Color Blindness. Discovery. John Dalton, an Engli...
tcacctcctgtagggcatct
tcacctcctgtagggcatct
by tawny-fly
▽. tggttgtttccaccttttgg. atgcatagtcacctttttga. ...
U nknown genetic predisposition
U nknown genetic predisposition
by tatyana-admore
in familial breast cancer . . can . lie deep in ...
U nknown genetic predisposition
U nknown genetic predisposition
by lois-ondreau
in familial breast cancer . . can . lie deep in ...
Division and
Division and
by lindy-dunigan
Differentiation . in . Human . C. ells. Writing i...
The genomics facilitator’s toolkit NTGLH_004 Whole
The genomics facilitator’s toolkit NTGLH_004 Whole
by tawny-fly
The genomics facilitator’s toolkit NTGLH_004 Who...
Haem Genomics update Chris Wragg, Haematological Cancer Lead Scientist,
Haem Genomics update Chris Wragg, Haematological Cancer Lead Scientist,
by ethlyn
South West Genomic Laboratory Hub. 23. rd. Februa...
National Childhood Cancer Registry
National Childhood Cancer Registry
by walter434
Long Term Outcomes of Children and Young Adults wi...
Screening of Genetic Variants in Familial Case of Myeloid Neoplasm Using Exome Sequencing
Screening of Genetic Variants in Familial Case of Myeloid Neoplasm Using Exome Sequencing
by edolie
State University of Campinas (UNICAMP). School of ...
Supplemental Figure 2: Sanger Trace of Putative Germline FANCA S858R Variant
Supplemental Figure 2: Sanger Trace of Putative Germline FANCA S858R Variant
by ava
WGA AML. WGA AML. Skin. Skin. WGA GCT. WGA GCT. FA...
A Comprehensive Review of p53 Mutations and Cancer Incidence in Companion Animals
A Comprehensive Review of p53 Mutations and Cancer Incidence in Companion Animals
by mary
Presented by: . Amit Levi. Class of 2022. Mentor:....
Readiness   level   of
Readiness level of
by finley
the. . Brazilian. . regulatory. framework: . ca...
Clinical interpretation of genomic variants
Clinical interpretation of genomic variants
by trinity
Harriet Feilotter, PhD, FCCMG, FACMG. Professor, D...
“Mainstream” Genetic Consultation
“Mainstream” Genetic Consultation
by ida
Patient meets eligibility criteria as per . Nation...
Clare Turnbull,  PhD FRCP
Clare Turnbull, PhD FRCP
by ash
FRCPath. MFPH MSc (Epidemiology). Professor in Tr...
Human germline modification
Human germline modification
by brianna
Fatal genetic . d. isorders . No cure. 1 in 3 inf...