Search Results for 'Germline'

Germline published presentations and documents on DocSlides.

Genomic/Genetic Testing Germline v Somatic testing and the importance of Molecular Tumor Boards
Genomic/Genetic Testing Germline v Somatic testing and the importance of Molecular Tumor Boards
by lois-ondreau
Ben Ho Park MD PhD. Johns Hopkins University. Fin...
Gene Therapy In and Around the Germline
Gene Therapy In and Around the Germline
by trish-goza
Kyle Orwig. Magee-. Womens. Research Institute. ...
Breakout session 1 Somatic-to-germline
Breakout session 1 Somatic-to-germline
by unita
testing . pathways. Format. Round table discussion...
Governance, Regulation, and Control:
Governance, Regulation, and Control:
by celsa-spraggs
Of Which People, By Which People, For Which Peopl...
Genetic testing in ovarian cancer
Genetic testing in ovarian cancer
by BlueEyedBeauty
Dr Katie Snape. Joint Lead Consultant for Cancer G...
IntroductionKnowledge of spatial and temporal gene expression proles
IntroductionKnowledge of spatial and temporal gene expression proles
by delilah
We performed a genome-wide analysis of gene expres...
UTSW Cancer Genetics
UTSW Cancer Genetics
by taylor
CancerGenetics@utsouthwestern.edu | 214 - 645 - 25...
European Medicines Agency 7 Westferry Circus Canary Wharf London E1
European Medicines Agency 7 Westferry Circus Canary Wharf London E1
by bery
ICH Considerations General Principles to Address...
Why and how to test for germline
Why and how to test for germline
by isabella2
BRCA. mutations in Pancreatic Cancer. ESDO Learni...
U nknown genetic predisposition
U nknown genetic predisposition
by lois-ondreau
in familial breast cancer . . can . lie deep in ...
Division and
Division and
by lindy-dunigan
Differentiation . in . Human . C. ells. Writing i...
U nknown genetic predisposition
U nknown genetic predisposition
by tatyana-admore
in familial breast cancer . . can . lie deep in ...
tcacctcctgtagggcatct
tcacctcctgtagggcatct
by tawny-fly
▽. tggttgtttccaccttttgg. atgcatagtcacctttttga. ...
Nathan Krohne
Nathan Krohne
by lois-ondreau
Color Blindness. Discovery. John Dalton, an Engli...
Experimental Medicine Trials of Promising HIV Candidates
Experimental Medicine Trials of Promising HIV Candidates
by phoebe-click
Robin Shattock. . Experimental . Medicine . Tria...
Human  Germline  Cycle
Human Germline Cycle
by faustina-dinatale
Specification . of Primordial Germ Cells. (PGCs) ...
State of the Art in  BRCA
State of the Art in BRCA
by ellena-manuel
-Mutated Ovarian Cancer. This program will includ...
ASHG  Workshop Classifying and Interpreting Germline and Somatic Variants in Your Large Cohort Stud
ASHG Workshop Classifying and Interpreting Germline and Somatic Variants in Your Large Cohort Stud
by tatyana-admore
Karchin Lab. Department of Biomedical Engineering...
Case Discussion: Second
Case Discussion: Second
by celsa-spraggs
Opinion. 55 year-old woman with . recurrent . ova...
Editorial governance in
Editorial governance in
by mitsue-stanley
germline. gene editing. Philip Campbell. Editor-...
The French Perspective The
The French Perspective The
by sherrill-nordquist
law. 1994. Civil code: . Art. 16-4. . <<. ...
Why ?   And what are the current alternatives ?
Why ? And what are the current alternatives ?
by natalia-silvester
The Francis Crick Institute, London, UK. Moderato...
 Patient Selection for PARP
Patient Selection for PARP
by sherrill-nordquist
Inhibitors:. Purpose and Practicalities . Present...
Please note, these are the actual video-recorded
Please note, these are the actual video-recorded
by blindnessinfluenced
proceedings from the live CME event and may includ...
MIWI and MILI find small partnersTwo independent reports reveal the ex
MIWI and MILI find small partnersTwo independent reports reveal the ex
by jones
DOI:10.1038/nrg1908URLs RNA WORLD ORIGINAL RESEARC...
molecular
molecular
by miller
HEVA screen is a kit for the analysis of the ATM, ...
Genomic Testing: When and Why?
Genomic Testing: When and Why?
by callie
Rob Finch, MS, CGC. Certified Genetic Counselor. M...
Human germline modification
Human germline modification
by brianna
Fatal genetic . d. isorders . No cure. 1 in 3 inf...
Human genome editing: ethics, engagement and governance
Human genome editing: ethics, engagement and governance
by ella
12 – 13 November 2019, Singapore. www.gfbr.globa...
Supplementary Fig . 1  (a)
Supplementary Fig . 1 (a)
by hadly
Phenotypic characteristics of caprine male germlin...
Clinical Benefit of Integrative Genomic Profiling
Clinical Benefit of Integrative Genomic Profiling
by ava
in Advanced Solid Tumors. EDRN Biomarker Developme...
Hereditary syndromes, genetic testing and
Hereditary syndromes, genetic testing and
by Kingslayer
gynaecological. cancers. Prof.. Nicoletta . Col...
proteins that can be engineered to induce a doublestrand break in a s
proteins that can be engineered to induce a doublestrand break in a s
by obrien
in animals such as rats the precise effects of gen...
Genomic Prostate Cancer Testing for Olaparib
Genomic Prostate Cancer Testing for Olaparib
by abigail
Laura Yarram-Smith . Solid Tumour Lead SWGLH. J...
Prudence in  Germline  Gene Editing
Prudence in Germline Gene Editing
by rose
The Urgent Need for Collaborative Partnerships in ...
Haem Genomics update Chris Wragg, Haematological Cancer Lead Scientist,
Haem Genomics update Chris Wragg, Haematological Cancer Lead Scientist,
by ethlyn
South West Genomic Laboratory Hub. 23. rd. Februa...
Clare Turnbull,  PhD FRCP
Clare Turnbull, PhD FRCP
by ash
FRCPath. MFPH MSc (Epidemiology). Professor in Tr...