Search Results for 'germline'

germline published presentations and documents on DocSlides.

Gene Therapy In and Around the Germline
Gene Therapy In and Around the Germline
by trish-goza
Kyle Orwig. Magee-. Womens. Research Institute. ...
Genomic/Genetic Testing Germline v Somatic testing and the importance of Molecular Tumor Boards
Genomic/Genetic Testing Germline v Somatic testing and the importance of Molecular Tumor Boards
by lois-ondreau
Ben Ho Park MD PhD. Johns Hopkins University. Fin...
Breakout session 1 Somatic-to-germline
Breakout session 1 Somatic-to-germline
by unita
testing . pathways. Format. Round table discussion...
Governance, Regulation, and Control:
Governance, Regulation, and Control:
by celsa-spraggs
Of Which People, By Which People, For Which Peopl...
Genetic testing in ovarian cancer
Genetic testing in ovarian cancer
by BlueEyedBeauty
Dr Katie Snape. Joint Lead Consultant for Cancer G...
IntroductionKnowledge of spatial and temporal gene expression proles
IntroductionKnowledge of spatial and temporal gene expression proles
by delilah
We performed a genome-wide analysis of gene expres...
UTSW Cancer Genetics
UTSW Cancer Genetics
by taylor
CancerGenetics@utsouthwestern.edu | 214 - 645 - 25...
European Medicines Agency 7 Westferry Circus Canary Wharf London E1
European Medicines Agency 7 Westferry Circus Canary Wharf London E1
by bery
ICH Considerations General Principles to Address...
Why and how to test for germline
Why and how to test for germline
by isabella2
BRCA. mutations in Pancreatic Cancer. ESDO Learni...
Breakout session 1 Somatic-to-germline testing
Breakout session 1 Somatic-to-germline testing
by natalia-silvester
Breakout session 1 Somatic-to-germline testing pat...
Haem Genomics update Chris Wragg, Haematological Cancer Lead Scientist,
Haem Genomics update Chris Wragg, Haematological Cancer Lead Scientist,
by ethlyn
South West Genomic Laboratory Hub. 23. rd. Februa...
Prudence in  Germline  Gene Editing
Prudence in Germline Gene Editing
by rose
The Urgent Need for Collaborative Partnerships in ...
Genomic Prostate Cancer Testing for Olaparib
Genomic Prostate Cancer Testing for Olaparib
by abigail
Laura Yarram-Smith . Solid Tumour Lead SWGLH. J...
proteins that can be engineered to induce a doublestrand break in a s
proteins that can be engineered to induce a doublestrand break in a s
by obrien
in animals such as rats the precise effects of gen...
Hereditary syndromes, genetic testing and
Hereditary syndromes, genetic testing and
by Kingslayer
gynaecological. cancers. Prof.. Nicoletta . Col...
Clinical Benefit of Integrative Genomic Profiling
Clinical Benefit of Integrative Genomic Profiling
by ava
in Advanced Solid Tumors. EDRN Biomarker Developme...
Prudence in Germline Gene Editing The Urgent Need
Prudence in Germline Gene Editing The Urgent Need
by yoshiko-marsland
Prudence in Germline Gene Editing The Urgent Need ...
Supplementary Fig . 1  (a)
Supplementary Fig . 1 (a)
by hadly
Phenotypic characteristics of caprine male germlin...
Clare Turnbull,  PhD FRCP
Clare Turnbull, PhD FRCP
by ash
FRCPath. MFPH MSc (Epidemiology). Professor in Tr...
“Mainstream” Genetic Consultation
“Mainstream” Genetic Consultation
by ida
Patient meets eligibility criteria as per . Nation...
Clinical interpretation of genomic variants
Clinical interpretation of genomic variants
by trinity
Harriet Feilotter, PhD, FCCMG, FACMG. Professor, D...
Readiness   level   of
Readiness level of
by finley
the. . Brazilian. . regulatory. framework: . ca...
A Comprehensive Review of p53 Mutations and Cancer Incidence in Companion Animals
A Comprehensive Review of p53 Mutations and Cancer Incidence in Companion Animals
by mary
Presented by: . Amit Levi. Class of 2022. Mentor:....
Supplemental Figure 2: Sanger Trace of Putative Germline FANCA S858R Variant
Supplemental Figure 2: Sanger Trace of Putative Germline FANCA S858R Variant
by ava
WGA AML. WGA AML. Skin. Skin. WGA GCT. WGA GCT. FA...
Screening of Genetic Variants in Familial Case of Myeloid Neoplasm Using Exome Sequencing
Screening of Genetic Variants in Familial Case of Myeloid Neoplasm Using Exome Sequencing
by edolie
State University of Campinas (UNICAMP). School of ...
National Childhood Cancer Registry
National Childhood Cancer Registry
by walter434
Long Term Outcomes of Children and Young Adults wi...
The genomics facilitator’s toolkit NTGLH_004 Whole
The genomics facilitator’s toolkit NTGLH_004 Whole
by tawny-fly
The genomics facilitator’s toolkit NTGLH_004 Who...
Case Discussion: Second
Case Discussion: Second
by celsa-spraggs
Opinion. 55 year-old woman with . recurrent . ova...
U nknown genetic predisposition
U nknown genetic predisposition
by lois-ondreau
in familial breast cancer . . can . lie deep in ...
Division and
Division and
by lindy-dunigan
Differentiation . in . Human . C. ells. Writing i...
U nknown genetic predisposition
U nknown genetic predisposition
by tatyana-admore
in familial breast cancer . . can . lie deep in ...
tcacctcctgtagggcatct
tcacctcctgtagggcatct
by tawny-fly
â–˝. tggttgtttccaccttttgg. atgcatagtcacctttttga. ...
Nathan Krohne
Nathan Krohne
by lois-ondreau
Color Blindness. Discovery. John Dalton, an Engli...
Experimental Medicine Trials of Promising HIV Candidates
Experimental Medicine Trials of Promising HIV Candidates
by phoebe-click
Robin Shattock. . Experimental . Medicine . Tria...
Human  Germline  Cycle
Human Germline Cycle
by faustina-dinatale
Specification . of Primordial Germ Cells. (PGCs) ...
State of the Art in  BRCA
State of the Art in BRCA
by ellena-manuel
-Mutated Ovarian Cancer. This program will includ...
ASHG  Workshop Classifying and Interpreting Germline and Somatic Variants in Your Large Cohort Stud
ASHG Workshop Classifying and Interpreting Germline and Somatic Variants in Your Large Cohort Stud
by tatyana-admore
Karchin Lab. Department of Biomedical Engineering...