PPT-Update on Spotted Wing Drosophila
Author : karlyn-bohler | Published Date : 2018-10-29
Lindsy Iglesias PhD Student Oscar E Liburd Professor UF Entomology amp Nematology Fall Blueberry Short Course October 2015 Plant City FL Outline SWD Biology Management
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Update on Spotted Wing Drosophila" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Update on Spotted Wing Drosophila: Transcript
Lindsy Iglesias PhD Student Oscar E Liburd Professor UF Entomology amp Nematology Fall Blueberry Short Course October 2015 Plant City FL Outline SWD Biology Management Strategies. BTEC Applied Science. Unit 18: Genetics. Assignment 3: Inheritance. Starter Quiz. For Each question, write down the answer in your notes…. Question 1:. Which is the Male fly?. A. B. Question 2. What mutation is this fly displaying?. By: gyazmin maestas. Survival status. The little spotted cat is threatened with extinction due to hunting for its fur . It is protected in several countries ,but in others hunting is still allowed their numbers suffer due to fur change.. Lindsy Iglesias, Ph.D. Student. Oscar E. . Liburd. , Professor. UF Entomology & Nematology. Fall Blueberry Short Course. October 2015. Plant City, FL. Outline. SWD Biology. Management Strategies. Wilson Leung 01/2014. Agenda. Overview of the modENCODE species. Problems with the version 1 genome assembly. Improvements in the version 2 genome assembly. Pipeline used to create the sequence improvement projects. ADRC 2014, San Diego. In this talk….. Why human disease models?. The data so far. Searching human disease model data. What’s next?. . 1993. 1998. 2003. 2008. 2013. Drosophila papers containing “disease” in the abstract or title. An introduction to web tools, . databases, and NCBI BLAST. Wilson Leung 12/2021. Agenda. GEP annotation project overview. Web databases for . Drosophila. annotation. UCSC Genome Browser. NCBI / BLAST. Mutant organisms. What is a mutant organism?. An organism with a permanent change to its genome. What are mutants used for in research?. Expression of a fluorescent protein in a single pair of neurons . Drosophila . melanogaster. Drosophila Melanogaster, a popular genetic model organism. ~ 50% of fly genes have vertebrate homologs. Small and easy to grow in lab. Short generation time . Produce high amounts of offspring. Figure 8-1. The Cell Cycle Figure 8-2. Metaphase Chromosome 1. A tissue culture is grown from a cell sample (biopsy). White blood cells, bone 2. The tissue cultur 2606 frame (ORF) was cloned into the I site of pAc5.1/c-MYC-HISAusing the following PCR primers: AcCYLD-F: 5-CCCGAATTCC A -AAATGATCTTAAACAACAA AAG TAAAAC-3CCCCTCGAGATGGTACATCATTA TATCTGTGC-3MYC-HIS A External Reviewer, Developmental Biology Programme, European Molecular &2003 Biology Laboratory, Heidelberg, Germany 2000, 2003, Member External Advisory Board of the Department of Biological Scie Rovery C, Brouqui P, Raoult D. Questions on Mediterranean Spotted Fever a Century after Its Discovery. Emerg Infect Dis. 2008;14(9):1360-1367. https://doi.org/10.3201/eid1409.071133. Parola P, Inokuma H, Camicas J, Brouqui P, Raoult D. Detection and Identification of Spotted Fever Group Rickettsiae and Ehrlichiae in African Ticks. Emerg Infect Dis. 2001;7(6):1014-1017. https://doi.org/10.3201/eid0706.010616. Erik . Gundacker. , . FNC14-948 . NCR-SARE’s Farmers Forum, 2016. Agenda. SWD Management using high tunnels. Expanding growing season to 9 months . Growing vertically . Vermicomposting for the farm.
Download Document
Here is the link to download the presentation.
"Update on Spotted Wing Drosophila"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents