3.4: Transcription and Translation

3.4: Transcription and Translation 3.4: Transcription and Translation - Start

2016-07-30 129K 129 0 0

Description

3.5.1: Compare the structure of RNA and DNA.. 3.5.1: Compare the structure of RNA and DNA.. IB Question: . Compare the structure and composition of DNA with RNA. . [4]. both are polymers of nucleotides / both nucleic acids;. ID: 425168 Download Presentation

Embed code:
Download Presentation

3.4: Transcription and Translation




Download Presentation - The PPT/PDF document "3.4: Transcription and Translation" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.



Presentations text content in 3.4: Transcription and Translation

Slide1

3.4: Transcription and Translation

Slide2

3.5.1: Compare the structure of RNA and DNA.

Slide3

3.5.1: Compare the structure of RNA and DNA.

Slide4

IB Question: Compare the structure and composition of DNA with RNA. [4]

both are polymers of nucleotides / both nucleic acids;

sugar is deoxyribose in DNA and ribose in RNA;

DNA is double stranded and RNA is single stranded;

DNA has a (double) helix;

DNA has thymine while RNA has uracil;

(require full names written out)

both contain four nitrogenous bases / A, G, C, T for DNA and A, G, C, U for RNA;

[4 max]

Slide5

3.5.2: Outline DNA transcription in terms of the formation of an RNA strandcomplementary to the DNA strand by RNA polymerase.

Slide6

3.5.3: Describe the genetic code in terms of codons composed of triplets of bases.

Slide7

Genetic code

Slide8

3.5.4:Explain the process of translation,leading to polypeptide formation.

Slide9

Translation

Slide10

What will be the sequence of amino acids from the following mRNA transcript?

UAUGGAGCGCUAUCGAUCGUUAGA

Slide11

IB Question: Explain the process of translation. [8]

messenger / mRNA attaches to ribosome (small unit);

many ribosome/polyribosomes bind to same mRNA;

carries codons / triplet of bases each coding for one amino acid;

transfer / tRNA each have specific anticodon;

triplet of bases for specific amino acid;

tRNA carries specific amino acid;

tRNA binds to ribosomes;

to corresponding triplet base / codon;

a second tRNA binds to next codon;

two amino acids bind together;

in a peptide linkage;

first tRNA detaches;

ribosome moves along mRNA;

another tRNA binds to next codon;

continues until polypeptide / protein formed to stop codon;

stop codon has no corresponding tRNA/amino acid / causes release of polypeptide;

[8 max]

Slide12

IB Question: Compare DNA transcription with translation. [4]

both require ATP;

DNA is transcribed and mRNA is translated;

transcription produces RNA and translation produces polypeptides/protein;

RNA polymerase for transcription and ribosomes for translation / ribosomes in translation

only;

transcription in the nucleus (of eukaryotes) and translation in the cytoplasm/at ER;

tRNA needed for translation but not transcription;

[4 max]

Slide13

One gene may code for multiple polypeptides due to alternative splicing

3.5.5: Discuss the relationship between one gene and one polypeptide.

Slide14

Slide15

Slide16

Slide17


About DocSlides
DocSlides allows users to easily upload and share presentations, PDF documents, and images.Share your documents with the world , watch,share and upload any time you want. How can you benefit from using DocSlides? DocSlides consists documents from individuals and organizations on topics ranging from technology and business to travel, health, and education. Find and search for what interests you, and learn from people and more. You can also download DocSlides to read or reference later.