1 CS273A Lecture 14 Inferring Evolution Chains amp Nets httpcs273astanfordedu Bejerano Fall1617 2 Announcements HW2 due in Projects due out TTATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATACATATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAG ID: 540408 Download Presentation
Download Presentation - The PPT/PDF document "http://cs273a.stanford.edu [Bejerano Fal..." is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Presentation on theme: "Http://cs273a.stanford.edu [Bejerano Fall16/17]"— Presentation transcript