PPT-2 Lecture 9: Algorithm Analysis

Author : myesha-ticknor | Published Date : 2019-03-12

Lets first look at the tests for 1 search N lg 2 N 8 3 16 4 1M 20 1G 30 64 6 32 5 1024 10 3 Lecture 9 Algorithm Analysis Now consider multiple searches Lets

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "2 Lecture 9: Algorithm Analysis" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

2 Lecture 9: Algorithm Analysis: Transcript


Lets first look at the tests for 1 search N lg 2 N 8 3 16 4 1M 20 1G 30 64 6 32 5 1024 10 3 Lecture 9 Algorithm Analysis Now consider multiple searches Lets say for example I need to do 1 million searches of 1 million items. 30pm 730pm 730pm 730pm Hold Your Applause Inventing and Reinventing the C lassical Concert Hold Your Applause Inventing and Reinventing the C lassical Concert Hold Your Applause Inventing and Reinventing the C lassical Concert Hold Your Applause I and Shavit-Francez termination algorithms. Index :. Introduction. Experimental Setup. Result Analysis. Conclusion. Future Work. Introduction. Dijkstra-Scholten. algorithm detects the termination of a centralized basic computation.. CS 477/677. Instructor: Monica Nicolescu. Lecture . 13. CS 477/677 - Lecture 13. Midterm Exam. Tuesday, . March 8 . in . classroom. 75 minutes. Exam structure:. TRUE/FALSE questions. short questions on the topics discussed in class. Execution?. Zhiyuan. Shao. , Lin . Hou. , Yan Ai, Yu Zhang and Hai Jin. Services Computing Technology and System Lab. Cluster and Grid Computing . Lab. Huazhong. University of Science and Technology. Mengdi. Wu x103197. 1. Introduction. What are Genetic Algorithms?. What is Fuzzy Logic?. Fuzzy . Genetic Algorithm . 2. What are Genetic Algorithms?. Software programs that learn in an evolutionary manner, similarly to the way biological system evolve.. Chun Zhang. Index . Introduction. Experimental Setup. Behavior Observation. Result Analysis. Conclusion. Future Work. Introduction---B. yzantine Algorithm. Commanding-general & lieutenants. each general (process) may be either loyalty or traitor (faulty). A computer algorithm is. a detailed step-by-step method for. solving a problem. by using a computer.. Problem-Solving (Science and Engineering). Analysis. How does it work?. Breaking a system down to known components. Algorithm. Input. Output. 1. Analysis of Algorithms. How long does this take to open 1) know 2) don’t know. . Analysis of Algorithms. 2. If know combination O(n) . where n is number of rings. . If the alphabet is size m, O(nm). 0010010010. 1001011100. 01010000110000101001. 1001011011. 0010100100. 00100100101. 10001010011. 10001010011010. ataacgtagcacatagtagtccagtagctgatcgtagaactgcatgatccaagctgctgatacgatgaacacctgagatgctgatgctgatagctagtcg. Syllabus. Lecture 01 Describing Inverse Problems. Lecture 02 Probability and Measurement Error, Part 1. Lecture 03 Probability and Measurement Error, Part 2 . Lecture 04 The L. 2. Norm and Simple Least Squares. Focus: developing algorithms . abstractly. Independent of programming . language, data types, etc.. Think of a stack or queue: not specific to C , but can be implemented when needed. Addressed in depth during COSC 320. Spring . 2018. Analyzing problems. interesting problem: residence matching. lower bounds on problems. decision trees, adversary arguments, problem . reduction. I. nteresting problem: residence matching. Today’s Lecture. Algorithm . Analysis. Asymptotic analysis. bigO. notation. Project 1. Checkpoint 1 due at 11:30 pm. Submit only the files listed in the deliverables section. If you submit as a group, make sure all files have both team names. 1. Uninformed Search. Computer Science cpsc322, Lecture 5. (Textbook . Chpt. . 3.5). Sept, 14, 2012. CPSC 322, Lecture 4. Slide . 2. Search is a key computational mechanism in many AI agents . We will study the basic principles of search on the simple .

Download Document

Here is the link to download the presentation.
"2 Lecture 9: Algorithm Analysis"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents