Purification and characterization of 37 kDa serine protease - PowerPoint Presentation

Slide1

Purification and characterization of 37 kDa serine protease zymogen from silkworm, Bombyx mori

Present by Mr.M.Kannan, M.Sc., PGDEG,Research Scholar Under the guidance of Prof. M.Krishnan Insect Molecular Biology laboratoryDepartment of Environmental BiotechnologyBharathidasan University, Tiruchirappalli-620 024Tamil Nadu, IndiaSlide2

PROF.M.KRISHNAN’S LABORATORY ACHIEVEMENTS ON MOLECULAR ENTOMOLOGYBenefits to sericulture industry

Dr.K.M. Subburathinam: A study on the hydrolyzed soy protein supplementation to the mulberry silkworm, Bombyx moriDr.X.Nirmala : Control of silk gene expression by dietary proteins in the fifth instar larvae of Bombyx mori Dr. Prasanta Kumar Kar: Molecular ecology and genetics of wild tasar silk worm (Antheraea mylitta Drury) in Similipal Biosphere ReserveDr.Nitin Kumar Singh: Vitellogenin from the Silkworm, Bombyx mori: An Effective Anti-Bacterial AgentDr. V. Arun Prasanna: Molecular characterization of Bmor 56 receptor from Silkworm Bombyx mori Benefits to Insect Pest Management programmeDr. U. Balasubramaniam: Studies on the toxic effects of insecticides, monocrotophos and cypermethrin on the mulberry silkworm, Bombyx mori Dr. A. Rajathi : Studies on the effects of a non-steroidal ecdysteroid agonist methoxyfenozide (RH-2485), on mulberry silkworm Bombyx mori Dr. P. Muthu Meenakshi: Studies on the molecular characteristics of insect vitellogenins and vitellogenin receptors in cotton pest,

Spodoptera litura

Dr.

R.Chandrasekhar

:

Expression and sequestration of differentiated fat body tissues of

groundnut pest,

Amsacta

albistriga

WalkSlide3

Taxonomy

Silkworm, B.mori is used for the study of physiology, development and molecular biology of other harmful insect pests, also act as a model to study the human disease (Krishnan and Konig, 2010).Life cycle of Bombyx mori is around 41±2 days. It consist four stages like egg, larva, pupa and adult. Classification Kingdom : Animalia Phylum : Arthropoda Class : Insecta Order : Lepidoptera

Family : Bombycidae

Genus :

Bombyx

Species : mori

Krishnan and

Konig,

2010Slide4

Silk gland

Fat body

Gut

Major organs in the larvae of

B.moriSlide5

The larval midgut is formed of an epithelial cell monolayer composed of columnar, goblet and stem cells (Cermenati

et al., 2007). The columnar cells are mainly responsible for food digestion and nutrition absorption. Midgut is also a barrier for the foreign substances during food digestion. It has been found that some proteins such as lipase, 28 kDa serine protease and SP-2 in midgut have antiviral activity against Bombyx mori nuclear polyhedrosis virus (BmNPV) (Ponnuvel et al., 2003; Nakazawa et al., 2004).Moreover, midgut has been recognized as one of the important targets for insect control using B. thuringiensis and silencing theexpression of vital genes using RNA interference (RNAi). These two are major tool in insect management (Hakim et al., 2010).Introduction Slide6

The midgut shows dramatic changes during transition from larva to pupa and adult

The pupa is the intermediate phase (Anti-feeding stage), when larval specific tissues such as fat body, silk gland and larval muscle undergo histolysis and histogenesis for grow into the organs and external structures of the adult (Wigglesworth, 1967).Proteolytic enzymes are key player in the degradation of structural components in larval tissues, as they are remodelled during metamorphosis (Law et al., 1977; Natori, 1999). To date, several types of proteases have been studied with respect to their participation in this midgut tissue remodelling based on their localization and stage-dependent expression. . Cathepsin-like proteases (Cathepsin L-like enzyme and cathepsin-D like enzyme )Matrix-metalloproteases (MMPs), Serine proteases and caspasesIntroduction cont…Slide7

Particularly, serine protease is involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development,

blood coagulation, immune responses, signal transduction, hormone activation, reproduction and tissue remodelling in insects (Nakajima et al., 1997).Previous studies shows that 37kDa serine protease was synthesized as a zymogen at larval stage and activated upon pupation and involved in midgut tissue remodelling of silkworm B.mori (Kaji et al., 2009). However, further role and molecular mechanism of 37kDa serine protease activation on midgut tissue remodelling in silkworm, B.mori is unclear.In the present study, we plan to characterize the 37kDa serine protease zymogen activation for better understanding insect gut physiology and exploit the active 37kDa serine protease as a drug to earlier activation of larval midgut tissue remodelling (lysis), that will pay a novel bio control strategy.Introduction cont…Slide8

Objectives

Purification and characterization of the 37 kDa serine protease of silkworm, Bombyx moriPrediction of domain, cleavage site of signal peptide and propeptide for 37kDa serine proteaseMolecular cloning and over expression of p37kDa serine protease zymogen of silkworm, Bombyx mori in E.coliExtraction and purification of p37kDa serine protease zymogenProteomic characterization of purified 37 kDa serine proteaseMolecular cloning and over expression of active serine protease (Ap37k) for insecticidal activitySlide9

Domain, Signal peptide and pro-peptide cleavage site detection were performed using SMART, signal P 4.1 tool and Prop 1.0 server respectively (Schultz

et al. 1998; Duckert et al., 2004).Molecular cloning and over expression (Sambrook et al., 1989; Novagen 10th edition of pET system manual).Extraction and purification of over expressed 37kDa serine protease by using immobilized affinity chromatography (Sambrook et al., 1989).Dialysis of purified protein (Sambrook et al., 1989).Quantification of purified protein by Bradford assay (Bradford, 1976).SDS-PAGE analysis of purified 37kDa serine protease (Laemmli, 1974).2-D PAGE analysis of 37kDa serine protease (2DE-DIGE manual, GE heath care).MALDI-TOF/MS analysis and database searching (IISc, Bangalore, India).Material and methodsSlide10

Results and discussionSlide11

37kDa serine protease precursor

MKWPVIMICLVGWSSCYTQRPIGQKDKGFIDWINNLLGGTTTTTTLRPIDDPPEDCPSCQCGIARTRRRIVGGYETKETEYPWMAALLYGGRFYCGGALISDLYVLTAAHCTSGFRKERITVRFLEHDRSKVNETKTIDRKVSDIIRHLRYNPGTYDSDIALLKLAERVDLSSALKRVRSEGDNGTATDDDKDVGLRPVCLPSSGLSYNNYTGVVTGWGTTEEGGSVSNALQEVKVPIVTNEECRKGYGDRITDNMICAGEPEGGRDACQGDSGGPMHVLEMETSKYSEVGVVSWGEGCARPNKPGVYTRVNRYLTWIKQNTRDACNCQ Theoretical pI/Mw: 6.46 / 36437.12 Slide12

SMART analysis of 37k serine protease of

B.moriMKWPVIMICLVGWSSCYTQRPIGQKDKGFIDWINNLLGGTTTTTTLRPIDDPPEDCPSCQCGIARTRRRIVGGYETKETEYPWMAALLYGGRFYCGGALISDLYVLTAAHCTSGFRKERITVRFLEHDRSKVNETKTIDRKVSDIIRHLRYNPGTYDSDIALLKLAERVDLSSALKRVRSEGDNGTATDDDKDVGLRPVCLPSSGLSYNNYTGVVTGWGTTEEGGSVSNALQEVKVPIVTNEECRKGYGDRITDNMICAGEPEGGRDACQGDSGGPMHVLEMETSKYSEVGVVSWGEGCARPNKPGVYTRVNRYLTWIKQNTRDACNCQSlide13

The signal P 4.1 server showed

predicted signal peptide site at 18th aa in p37kPrediction of signal peptide by Signal P- 4.1Slide14

Prediction of signal peptide and propeptide using ProP 1.0

ProP 1.0 predicts that removal of propeptide at 68aa region in the sequences leads to formation of mature protease.Signal peptidePro-peptideMature protein1-1819-6869-329Slide15

Bombyx mori 

37-kDa protease (P37k), mRNANCBI Reference Sequence: NM_001135203.1GenBank Graphics>gi|206725502|ref|NM_001135203.1| Bombyx mori 37-kDa protease (P37k), mRNATGCGAGCATCGCGGTGGTCAAAGTCGCTCGCCGTCCTTGATTTCGGGCCTTGAATACGTACGCGTTGGTGTTATAGATCTCTGCATATCGTCAATCGATATTTTGTTATCAACAATGAAATGGCCAGTGATTATGATCTGCCTGGTTGGTTGGTCGAGCTGCTACACCCAGCGGCCCATCGGTCAGAAGGATAAAGGATTTATAGACTGGATCAACAATCTCCTTGGCGGCACAACGACTACCACGACTTTAAGACCTATAGACGACCCGCCCGAGGACTGCCCAAGCTGTCAATGCGGCATAGCACGCACTCGTCGGCGCATCGTGGGCGGATATGAAACGAAAGAGACGGAGTACCCCTGGATGGCCGCTCTTTTGTACGGCGGAAGATTCTATTGTGGTGGTGCACTTATCAGTGATCTGTACGTTTTGACAGCTGCTCATTGTACTTCAGGATTCCGCAAGGAACGGATTACAGTTCGGTTCTTGGAGCACGATCGTTCTAAAGTAAACGAAACTAAAACGATAGACAGAAAGGTGTCTGACATCATTCGTCATCTGCGGTATAATCCCGGAACTTACGACAGTGATATCGCCCTTTTAAAACTAGCTGAGAGGGTAGACCTCAGCAGTGCATTGAAGCGAGTTCGCAGTGAAGGAGACAATGGCACTGCCACGGATGACGACAAGGACGTCGGGCTAAGACCGGTCTGTTTACCCAGTTCTGGACTCTCCTATAACAATTACACGGGTGTTGTCACAGGCTGGGGAACTACAGAGGAAGGTGGCTCTGTATCCAATGCATTACAGGAGGTGAAAGTACCGATTGTGACAAATGAAGAATGTCGTAAAGGCTACGGTGATCGGATAACAGATAATATGATTTGCGCTGGGGAGCCAGAGGGCGGCCGTGACGCTTGTCAGGGAGACTCGGGTGGACCGATGCATGTTCTTGAAATGGAGACATCAAAATACTCTGAAGTCGGTGTCGTGTCTTGGGGCGAAGGGTGCGCGCGACCAAACAAACCAGGCGTTTATACCCGTGTCAATCGATACCTCACTTGGATTAAACAGAACACTCGCGATGCCTGCAATTGTCAATAAAAACACTGCTATGGTTTAAACATCGCACCCTGGTTCCAGATTTTCGTAGGAGGCTTTTAACTAATTGTTCAAATGACAAATTGTACACCTTTGTTTTACTTCTTGGTGCCTCGTCGTTATCGGAGGTTGACTGATATGTTCTACAAATTGTTTCTCAGATAAATTTAATTAATGTTTAATATATTATACGATGTATGAAATTTTAATTTATTAAG

Primer used for amplification of 37 kDa protease gene

p37k F: 5’-CCG

GAATTC

ACAATGAAATGGCCAGTG-3’

Eco

R1

p37k R: 5’-CCC

AAGCTT

TTATTGACAATTGCAGGC-3’

Hind

IIISlide16

PCR amplification and Cloning of 37 kDa serine protease gene into pET30a vector

ABp37k serine protease at 987 bp after digestionpET30a Kb M 1 2p37k gene A : Before DigestionM for DNA ladderLane 1 for pET30a Vector undigested

Lane2 for p37k insert undigested

B: After Digestion with Restriction enzyme

ECO-R1

and

HIND IIIM: DNA ladder

Lane 1: pET30a Vector digested

Lane2: p37k insert digested

pET 30 a

10

3

1

10

3

1

Kb M 1 2Slide17

pET30a Vector MapSlide18

Transformed colonies of p37k in the Kanamycin supplemented LB agar plate

Grown of Kanamycin resistant positive colonies in white colourSlide19

Confirmation of p37k clone by PCR (A) and Restriction digestion (B)

Kb M C1 C2 C3 C4 C5 C6 C7 C8 C9 C10 N JM101 Kb M L1 L2M :DNA size marker (1 kb, Biotool, Spain L1: uncut pET30b L2:The pET30b digested by EcoR1 & Hind III P37k gene was amplified using T7 Promoter and Terminator Primer M: DNA size marker (1 kb, Biotool, Spain) L1: L1, C3 to C10: p37 k clonep37kat 1300 bp pET30a@ 5422bpp37k @987bp After confirmation, the construct was transformed in to E.coli BL21 (DE3) for over expression

10

3

1

10

3

1Slide20

Mechanism of protein expression in PET seriesSlide21

100

5020Total Cell protein (TCP)Soluble fraction (SF)Insoluble body fraction (ISF)M :Stands for Molecular weight marker (Purchased from Thermo scientific)Lane 1: pET UninducedLane2:pET InducedLane 3: p37k UninducedLane4: p37k Induced (0.5mM)Lane 5: p37k Induced (1 mM)Lane 6: p37k Induced (1.5 mM) kDa M 1 2 3 4 5 6 M 1 2 3 4 5 6

M 1 2 3 4 5 6

SDS-PAGE profile for expression of p37k with His-tag in TCP, SF& ISF

The induced and un-induced protein extracts in each TCP, SF and ISF were separated on 12%SDS-PAGE and proteins were stained with CBBR-250

Expression of p37KSlide22

M C L1 L2 L3

SDS-PAGE analysis of p37k supernatant after Ammonium sulphate precipitation M : Protein markerC : Whole cell proteinL1: extracellular protein precipitated with 30 % NH2SO4L2: extracellular protein precipitated with 50 % NH2SO4L3: extracellular protein precipitated with 70 % NH2SO4 Absence of p37k expression as extracellular proteinkDa250130957255352810Slide23

Extraction and Purification of recombinant

37 kDa serine protease The purification of 37 kDa serine protease done by using immobilized metal affinity chromatography (Ni-NTA agarose). The purified products were separated on 12% SDS-PAGE and protein bands were stained with CBBR-250. L1 1: standard molecular marker; L2: Crude extract; L3: Unbound; L 4-5: 5 wash and 10 wash. The purified p37kDa serine protease was visualized as single band in lane 6 and 7 with molecular weight of 45kDa (37kDa of serine protease+8kDa of N-terminal vector regions).Purified 37kDa serine protease Slide24

2D-PAGE analysis of purified 37 kDa serine protease

Arrow indicates the obtained spots for purified 37 kDa serine protease at MW 45 kDa with pI approximately at 6.5-6.8. M- Protein marker12 % SDS-PAGE 3 Isoelectric focusing 10 M Slide25

MALDI-TOF-MS analysis of 2D-protein spot

The MALDI-TOF chromatogram shows a large broad protein peak at 1655.786.The protein score 99 matched to 37kDa serine protease precursor (Bombyx mori).The figure shows the 42% protein sequence coverage.(a)(b)(c)Slide26

Mature serine protease gene sequence (from p37k) for amplification

CGCATCGTGGGCGGATATGAAACGAAAGAGACGGAGTACCCCTGGATGGCCGCTCTTTTGTACGGCGGAAGATTCTATTGTGGTGGTGCACTTATCAGTGATCTGTACGTTTTGACAGCTGCTCATTGTACTTCAGGATTCCGCAAGGAACGGATTACAGTTCGGTTCTTGGAGCACGATCGTTCTAAAGTAAACGAAACTAAAACGATAGACAGAAAGGTGTCTGACATCATTCGTCATCTGCGGTATAATCCCGGAACTTACGACAGTGATATCGCCCTTTTAAAACTAGCTGAGAGGGTAGACCTCAGCAGTGCATTGAAGCGAGTTCGCAGTGAAGGAGACAATGGCACTGCCACGGATGACGACAAGGACGTCGGGCTAAGACCGGTCTGTTTACCCAGTTCTGGACTCTCCTATAACAATTACACGGGTGTTGTCACAGGCTGGGGAACTACAGAGGAAGGTGGCTCTGTATCCAATGCATTACAGGAGGTGAAAGTACCGATTGTGACAAATGAAGAATGTCGTAAAGGCTACGGTGATCGGATAACAGATAATATGATTTGCGCTGGGGAGCCAGAGGGCGGCCGTGACGCTTGTCAGGGAGACTCGGGTGGACCGATGCATGTTCTTGAAATGGAGACATCAAAATACTCTGAAGTCGGTGTCGTGTCTTGGGGCGAAGGGTGCGCGCGACCAAACAAACCAGGCGTTTATACCCGTGTCAATCGATACCTCACTTGGATTBmAp37k F: ATTCCATATGCGCATCGTGGGCGGATATGA Nde1BmAp37k R: CCGCTCGAGAATCCAAGTGAGGTATCGATTG Xho1Slide27

M : 1 kb marker

L1-L5 :gradient temperatureL6: Negative control (Water as template)After Digestion with Restriction enzyme Nde 1 and Xho 1M for DNA ladderL1: pET30b Vector digestedL2:p37k insert digestedAp37k PCR amplification and cloning Kb M L1 L2 L3 L4 L5 1031 Kb M L1 L21031pET30b with 5,4 22 bpAp37k with 750bp

Ap37k with 750bpSlide28

Grown of Kanamycin

resistant positive colonies in white colourAp37k construct in E.coli BL21 (DE3) in LB agar plateSlide29

Confirmation of Ap37k clone by PCR

Kb M L1 L2 L3 L4 L5 L6 L7 L8 L9 L101031P37k gene was amplified using T7 Promoter and Terminator Primer M: DNA size marker (1 kb, Biotool, Spain) L1: L1-L3, L5, L10-Ap37k clone, other are negative resultsSlide30

Confirmation of Ap37k clone for over expression

Trypsin like serine protease gene was amplified using gene specific primerM: DNA size marker (1 kb, Biotool, Spain) L1 and L2: Negative control and Positive control (p37k) L3 : clone (Ap37k)L4: pET30b UndigestedL5: pET30b Double digested,L6: Ap37k construct Undigested, L7: Ap37k construct single digested with Xho 1L8: Ap37k construct double digested with Nde1 and Xho 1 Kb M L1 L2 L3 L4 L5 L6 L7 L8 1031pET30b with 5,4 22 bpAp37k Insert released at 750bpAmplification of Ap37k with 750bpSlide31

A: pET30b induced; B:Ap37k clone un-induced; C:Ap37k clone inducedRed arrow indicate the protease activity of Ap37k lysate

Further large scale over expression and purification of active serine protease (Ap37k) is ongoing in our laboratory for the application of insecticidal activityProtease assayACBSlide32

Summary and Conclusion

Molecular characterization of 37kDa serine protease will be helpful for the understanding of midgut physiology in silkworm, B.mori The present study successfully cloned and over expressed the 37kDa serine protease zymogen in BL21 (DE3) at optimized temperature (22°C) and IPTG (1mM) induction.The expression of desired protein was observed in soluble fraction around >40% at 42.5 kDa.Over expressed 37kDa serine protease zymogen was successfully purified by immobilized affinity chromatography using Ni-NTA agarose resin. The purified 37kDa serine protease zymogen molecular weight and pI was observed as 42.5kDa and 6.4 respectively. This result similar to theoretical pI/Mw is 6.46/37 kDa.Slide33

The MALDI-TOF-MS results confirmed that the over expressed purified protein spot was 37kDa serine protease.

Mature form of serine protease (Ap37k) was amplified and cloned for over expression.Isoelectric point of ap37k was observed at 5.91. Acidic pH may play a major role in the p37k activation.Further work is ongoing in our laboratory for the identification zymogen activation factor and access the Ap37k insecticidal activityIn future, the development of this enzyme as a biopesticide will be much helpful for insect pest management through a environmental friendly approach.Summary cont….Slide34

Singh, N.K., B.C.Pakkianathan, M. Kumar,

T.Prasad, M. Kannan, S. Kong and M.Krishnan. 2013. Vitellogenin from the Silkworm, Bombyx mori: An Effective Anti-Bacterial Agent. PLoS One. 8:1-8 (IF-3.568).Mani Kannan, Thangaiyan Suganya, Vimalanathan Arun Prasanna, Neelamegam Rameshkumar and Muthukalingan Krishnan .2015. An Efficient Method for Extraction of Genomic DNA from Insect Gut Bacteria - Culture dependent. Current Research in Microbiology and Biotechnology 3(1): 550-556.M. Kannan, S. Anbalagan, M. Krishnan, K. Muthukrishnan and V. Gokula. 2015. New Record of the genus Euclea (Lepidoptera: Limacoididae) from South India revealed by DNA Barcoding. International Journal of Pure and Applied Zoology. 3, (1): 92-97 (IF-0.2).Anbalagan, S., Balachandran, C., Arunprasanna, V., Kannan, M., Dinakaran, S. and Krishnan, M. 2015. A new species of Simulium (Gomphostilbia) (Diptera: Simuliidae) from South India. Zootaxa 3974, 555–563 (IF-1.1).Anbalagan, S., Arunprasanna, V., Kannan, M., Dinakaran, S. and Krishnan, M. (2015) Simulium (Gomphostilbia) (Diptera: Simuliidae) from Southern Western Ghats, India: two new species and DNA barcoding. Acta Tropica. 149, 94–105 (IF-2.75). PublicationsSlide35

Our team

V.Arun Prasanna T.Suganya P.Malini N.Jothi N.Pauline T. Ramya V. Surya aathmanathanProf.M.Krishnan, MentorSlide36

Acknowledgement

I gratefully acknowledge Board of Research in Nuclear Science (BRNS), Mumbai (Reference No.2010/34/6/BRNS 769/dated 14.06.2010) for their financial assistance for this Project and JRF. I thank our Bharathidasan University, Trichy, TN, DST-FIST, UGC-NON-SAP, New Delhi for providing the sophisticated instrumentation and research facility.I extend my sincere thanks to CTEP-DBT International Travel Grant award to participate in the Asia Pacific Biotech Congress 2015 @ Beijing, China.I thank to Professor Tsunaki Asano, Department of Biological sciences, Metropolitan University, Japan for providing me the 37 kDa serine protease EST clone. I thank to Professor. Heng Wang, Department of Microbiology and Parasitology, Institute of Basic Medical Sciences, Beijing, China and Dr. Shailendra K Verma, Division of Microbiology, DRDE, Jhansi Road, Gwalior, India for their timely help.Slide37

I have gained an immense knowledge on Biotechnological applications and had an wonderful experience in this conference. Now the conference gave a wonderful opportunity to search “Post Doc” position abroad on Molecular Biology……..

Thanks to organizing committee of this conference…….Slide38

Thank YouOur favorite insect