/
Detecting Variation UNIT 03 Detecting Variation UNIT 03

Detecting Variation UNIT 03 - PowerPoint Presentation

phoebe-click
phoebe-click . @phoebe-click
Follow
375 views
Uploaded On 2018-09-21

Detecting Variation UNIT 03 - PPT Presentation

Detecting Variation In populations or when comparing closely related species one major objective is to identify variation among the samples AKA one of the main goals in genomics is to identify what genomic features make individualspopulationsspecies different ID: 674598

detecting variation read genome variation detecting genome read methods sequence sequencing exome loci tgaacgttatcgacgttccgatcgaactgtcagcggc size regions restriction variants reference duplication single samples

Share:

Link:

Embed:

Download Presentation from below link

Download Presentation The PPT/PDF document "Detecting Variation UNIT 03" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.


Presentation Transcript