PPT-Estimates of Genetic Ancestry

Author : MrRightNow | Published Date : 2022-08-04

Sequence Analysis Workshop May 2015 University of Michigan TakeHome Points Allele frequencies differ between populations These difference cause confounding Using

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "Estimates of Genetic Ancestry" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

Estimates of Genetic Ancestry: Transcript


Sequence Analysis Workshop May 2015 University of Michigan TakeHome Points Allele frequencies differ between populations These difference cause confounding Using population as covariate may control such confounding. 442 Los Angeles 5665780 4892 Chicago 3534080 3052 Philadelphia 2963500 2559 DallasFt Worth 2655290 2293 San FranciscoOakSan Jose 2518900 2175 Boston Manchester 2433040 2101 Washington DC Hagrstwn 2412250 2083 Atlanta 2375050 2051 10 Houston 2289360 1 You wont use them all at once but each can help you zero in on your search for answers Start by entering everything you know about the people in your family line into your Ancestrycom family tree Include modern details as well as records you uncover com and Ancestry Library Edition USER EXPERIENCE Ancestrycom is designed for the individual so th ere are a lot of persona lized functionality and options available to pr ivate subscribers that are not available in the Library Edition The following i Searching Your Family History: Cardinal Rules of Genealogy Research 1. Begin collecting information with the known, yourself, and work backward one generation at a time towards the unknown Perry, Petros & students. Objective of our analysis. Based on the output of ADMIXTURE, we want to quantify the amount of shared ancestry between two populations. . Even more, we would like to answer questions of the form: “How much ancestry is shared between population X and Y, on top of the ancestry that population X shares with population Z?”. Introduction: Human Population Genomics. ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG. Cost. Killer apps. Roadblocks?. How soon will we all be sequenced?. Time. 2013?. 2018?. Cost. Applications. enter at www.ancestry.com/learn . F or account questions or technical help, call 1 - 800 - 262 - 3787 . Created by : Amy Johnson Crow, CG Anne Gillespie Mitchell Juliana Smith 5 Steps to a Healthy ancestor, ancestry . heritage . d. escend from, descendants . P. hysicist, oceanographer and broadcaster. Politician, Labour MP. English international cricketer. Film director. TV P. resenter, businesswoman. ORIGIN AND DYNAMICS OF ADMIXTURE IN BRAZIL: IMPLICATIONS FOR HEALTH. Eduardo . Tarazona. Santos. UFMG. Iniciativa EPIGEN-Brasil: recolhendo duas tradições científicas na era genômica e do big data. 31302928272625292427232322212029192518272725172919162129151426271729rf2911ntt30bbb7261621251665161816423167141820Emergency911DAs279-0111408800far-reachingcommunitydepartmentseffortsYescolorancestrydis SCREENing. Kathy Morris, . mssw. , . lcgc. Senior genetic counselor. objectives. Know current ACOG guidelines about genetic disease carrier screening. Name 3 ethnic-specific genetic diseases. Know how to order or arrange carrier screening. Loic Yengo, PhD. Institute for Molecular Bioscience. The University of Queensland. l.yengo@imb.uq.edu.au. 1. What quantitative genetics tells us about heritability?. Part 1. 2. Outline. Definition of heritability (and genetic correlation). P-value. OR. IR. Lactose Intolerance. rs4988235. .09. 2.7. 1.2. Eye Color. rs. 7495174. .0093. 0. inf. Asparagus. rs4481887. .084. 2.35. 1.18. Bitter Taste. rs. 713598. .000498. 0.22. 0.519. Earwax. rs. Genotation. /traits/height. Fill out form.. Submit SNPs. SNPedia. The . SNPedia. website. http://www.snpedia.com/index.php/SNPedia. A thank you from . SNPedia. http://snpedia.blogspot.com/2012/12/o-come-all-ye-faithful.html.

Download Document

Here is the link to download the presentation.
"Estimates of Genetic Ancestry"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents