Constructing Their Own Knowledge to Understand Mutation Lauren Schultz Trista Strauch Tasia Taxis Lindsey Veautour Facilitator John Merrill Background Please respond as a student in intro bio ID: 422974
Download Presentation The PPT/PDF document "Students" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Slide1
Students Constructing Their Own Knowledge to Understand MutationLauren Schultz, Trista Strauch, Tasia Taxis, Lindsey Veautour Facilitator: John MerrillSlide2
BackgroundPlease respond as a student in intro bio You’ve been exposed to basic info about mutation, phenotype, genotype, and central dogma.Slide3
30-Second SentenceWrite down a definition of mutationSlide4
1. An organism fails to thrivein its environment. Is this a mutation? Yes A No BSlide5
2. An organism is exceptionally successful in its environment. Is this a mutation? Yes A No BSlide6
3. An organism has a new variant protein that is detrimental. Is this a mutation? Yes A No BSlide7
4. An organism has a new variant protein that is beneficial. Is this a mutation? Yes A No BSlide8
5. There is a genetic change that results in no change in the protein. Is this a mutation? Yes A No BSlide9
An organism fails to thrive in its environment. An organism is exceptionally successful in its environment. An organism has a new variant protein that is detrimental. An organism has a new variant protein that is beneficial. There is a genetic change that results in no change in the protein.Slide10Slide11
VotePositive Mutation ANegative Mutation BSlide12
Defend your vote to your neighborSlide13
RevotePositive Mutation ANegative Mutation BSlide14
HolsteinPiedmonteseBelgian BlueSlide15
Teaching ChallengeStudents memorize a definition of mutation as a “change in the genetic material,” but hold onto misconceptions that are at odds with this definition. Teachable Unit FrameworkSlide16
Learning ObjectivesStudents will formulate a working definition of a mutation and use it assess whether a mutation has occurred. Tidbit One- 30 second paper, Guided-Inquiry Clicker QsGiven various scenarios, students will be able to evaluate whether a mutation will lead to a phenotypic variation. Tidbit Two- Double-Muscle Cattle ScenarioStudents will be able to predict how a given mutation would change an individual’s fitness in a specific environment.Students will be able to show that mutations comprise the basis of genetic variability in a population.Teachable Unit FrameworkSlide17
Sickle-Cell Case Study- Mutations can affect an organism’s fitness based on environment. Tidbit #3Slide18
A mutation occurs such that there is a single amino acid change in the resultant protein. If an individual has two copies of this mutated gene, an illness occurs that can lead to frequent infections and shortened lifespan. Individuals with a single copy of this variant have 60% protection against mortality from an
endemic disease
.
Would you expect this gene variant to persist in the population?
Tidbit #3Slide19
Coat Color Variation Scenario- Mutations comprise the basis of genetic variability. Tidbit #4Slide20
A small group of animals moves from the mainland to an island, founding a new population. There is no subsequent movement of animals on or off the island. This initial population included coat color variation. Some years afterward, however, a new pattern variation arose that was previously not observed in the population. Following subsequent genetic analysis, it is determined that this haircoat is the result of a new variant of a protein. In simplest terms, how did it arise?Tidbit #4Slide21
Post Class Formative AssessmentQuestion #Change in DNAChange in Protein
Change in Phenotype
Effect on Organism
Is this a Mutation?
Why or Why Not?
1
Yes
Yes
Yes
Negative
Y
There is a change in DNA.
2
Yes
Yes
Yes
Positive
Y
There is a change in DNA.
3
Yes
Yes
Yes
None
Y
There is a change in DNA.
4
Yes
Yes
No
None
Y
There is a change in DNA.
5
Yes
No
No
None
Y
There is a change in DNA.
6
No
YesNoNoneNNo change in DNA. 7NoNoNoNoneNNo change in DNA.
Learning Objectives 1 and 2Slide22
Post Class Formative AssessmentLearning Objectives 3 and 4You have new variations of haircoat—dark with stripes, dark with no stripes, light with stripes, and light with no stripes. Consider the selective pressures that might exist on an island, and how this variation in coat color and pattern could impact survival and fitness in different habitats on the island. Pick one of the coat colors and describe an environment on this island where you think this variant would have better fitness than the other variants. Slide23
Summative AssessmentLearning Objectives 1 and 2ACTGCCTGATACATGTAGGC Based on the sequence above decide whether a mutation occurred, and predict any effect on the population. Suppose the sequence shown above is part of the non-coding portion of a chromosome. The first G from the left in the above sequence changes to an A. Did a mutation occur? Predicted effect on the population: Suppose the sequence shown above is part of the non-coding portion of a chromosome. The first G from the left in the above sequence changes to a C. Did a mutation occur? Predicted effect on the population: Slide24
Thank you!