PPT-Whole metagenome shotgun sequencing is a potentially powerf
Author : alida-meadow | Published Date : 2016-03-28
Abstract Background Methods To improve the mapping of metagenomederived DNA sequence to homologous protein coding sequences in reference databases we have developed
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Whole metagenome shotgun sequencing is a..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Whole metagenome shotgun sequencing is a potentially powerf: Transcript
Abstract Background Methods To improve the mapping of metagenomederived DNA sequence to homologous protein coding sequences in reference databases we have developed an algorithm that maps sequence reads to a reference in the amino acid space . Shotgun Cache and mynewshotgun.com provide top-notch new and used target and sporting shotguns along with great customer service and support - a combination that can't be beat! And to see your target more clearly let Susie outfit you with a set of Decot Sport Glasses. The "Shooters Choice". SHOW ALL. HIDE ALL. A. B. C. D. E. F. G. H. I. Shotgun Cartridge . SHOW ALL. HIDE ALL. B. C. D. E. F. G. H. I. A . cartridge or round packages the bullet, gunpowder, and primer into a single metallic case precisely made to fit the firing chamber of a firearm.. Sanger DNA sequencing, as you may guess, only works primer (best from about 30 nt to 350 nt; the Next-generation shotgun sequencing approaches require sequencing every base in a sample several times for two reasons: Last lecture summary. recombinant DNA technology. DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA). DNA cloning – vector (plasmid, BAC), PCR. genome mapping. relative locations of genes are established by following inheritance patterns. Dan . Russell. Overview. Prologue: Assembly and Finishing. The Past: Sanger. The Present: Next-Gen (454, . Illumina. , …). The Future: ? (. Nanopore. , . MinION. , Single-molecule). Overview. Prologue: Assembly and Finishing. Dan . Russell. The past, present, and future of DNA . sequencing*. Dan . Russell. *DNA sequencing:. D. etermining the number and order of nucleotides that make up a given molecule of DNA.. (Relevant) Trivia. Venter et. al (2004). Presented by. Ken . Vittayarukskul. Steven S. White.. Context of the Problem . Evolutionary history is directly tied to microbial genetics. Little is known. Until recently, microbial diversity was measured by PCR amplification and sequencing of only ribosomal genes. Hadza. Hunter-Gatherer Gut Microbiota. Rampelli. . et al. ., 2015. Bethsabe. Romero & Albert Cadag. Overview. Microbiome – microorganisms within a particular environment (the body or a specific part of the body). Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA). DNA cloning – vector (plasmid, BAC), PCR. genome mapping. relative locations of genes are established by following inheritance patterns. Modified from Dan Russell. (Relevant) Trivia. How many base pairs (bp) are there in a human genome?. How many protein coding genes are in the Human genome. How much did it cost to sequence the first human genome?. 1 David Wishart, Ath3-41 DNA Sequencing 2 Principles of DNA Sequencing PBR322AmpTet DNA fragmentDenature withheat to producessDNAKlenow+ ddNTP+ dNTP+ primers The Secret to Sanger Sequencing 4 Capillar B PV Phycisphaeraceae bacterium NQV32911. B PV . Sedimentisphaerales. bacterium MBN1360960. B Pr Halothiobacillaceae bacterium HER34048. B PV Phycisphaerae bacterium NLZ06667. PM2 MCP 2017 marine sediment metagenome gene 10 LAZR01002459 10745.
Download Document
Here is the link to download the presentation.
"Whole metagenome shotgun sequencing is a potentially powerf"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents