PPT-Whole Genome Sequencing

Author : trish-goza | Published Date : 2018-10-09

for Colorectal Cancer Ulrike Riki Peters Fred Hutchinson Cancer Research Center University of Washington Overview Significance and rationale Current efforts

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "Whole Genome Sequencing" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

Whole Genome Sequencing: Transcript


for Colorectal Cancer Ulrike Riki Peters Fred Hutchinson Cancer Research Center University of Washington Overview Significance and rationale Current efforts on rare and less frequent variants. What is Whole Disk Encr yp tion Whole Disk Encr yp tion versus File Encr yp tion sequencing . for . identification,. detection, . and control of . Bactrocera dorsalis (. Hendel. ). and other Tephritid pests. Thomas Walk, Scott . Geib. USDA-ARS Pacific Basin Agricultural Research Center, Hilo HI. Lenka Veselovská. Laboratory of Developmental Biology and Genomics . Next Generation Sequencing (NGS) . M. odern high-throughput DNA sequencing technologies. parallel, rapid . Decreasing price, time, workflow complexity, error rate. Timetable for today. Time. Activity. 00:00. Introduction to the session. 00:10. Story cards . 00:20. Info cards. 00:30. Issue cards. 00:40. Discuss two key. issues. 00:45. Feedback your issues. What is DNA?. Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. (very) large datasets. 5/24/18. Goals for the course. Understand how next-generation sequencing technologies are used in biomedical research. Learn how to use publicly available databases/websites to find specific information about genes. tens of thousands of DNA bases in length. Fugu is thedraft sequenced after human. Its compact form and sim-sequence. We now have in hand the basic gene-leveldescription of two vertebrates. Compari Knowing how many genes determine a phenotype (Mendelian and/or QTL analysis), and where the genes are located (linkage mapping) is a first step in understanding the genetic basis of a phenotype . A . Tim Graubert, MD. Division of Oncology, Stem Cell Biology Section. Washington University School of Medicine. Siteman Cancer Center. Genome Center at Washington University. Genome Center Leadership. Rick Wilson. . In the paper, researchers describe the final product of the Human Genome Project, which was the 13year effort to read the information encoded in the human chromosomes that reached its culmination i for suspected cancer Information for patients and family members Genomic Medicine Service NHS What is your genome? Your genome is the information needed to build the human body and keep it health T – Its History and Advancements into New Research and Technology Jutta Marzillier , Ph.D Lehigh University Biological Sciences September 5 th , 2014 Objectives Techniques that enabled genome sequ Vince Buonaccorsi. Juniata College. Cost of sequencing. https://www.genome.gov/about-genomics/fact-sheets/Sequencing-Human-Genome-cost. Next (2. nd. ) Generation Sequencing. How does Illumina sequencing work?. gonorrhoeae. antibiotic . susceptibility: toward tailored antimicrobial . therapy. Laura Phillips. Whole genome sequencing to predict . Neisseria gonorrhoeae . (NG) antibiotic susceptibility: towards tailored antimicrobial therapy..

Download Document

Here is the link to download the presentation.
"Whole Genome Sequencing"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents