PPT-Whole genome sequencing to predict Neisseria
Author : elio628 | Published Date : 2024-10-25
gonorrhoeae antibiotic susceptibility toward tailored antimicrobial therapy Laura Phillips Whole genome sequencing to predict Neisseria gonorrhoeae NG antibiotic
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Whole genome sequencing to predict Neiss..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Whole genome sequencing to predict Neisseria: Transcript
gonorrhoeae antibiotic susceptibility toward tailored antimicrobial therapy Laura Phillips Whole genome sequencing to predict Neisseria gonorrhoeae NG antibiotic susceptibility towards tailored antimicrobial therapy. sequencing . for . identification,. detection, . and control of . Bactrocera dorsalis (. Hendel. ). and other Tephritid pests. Thomas Walk, Scott . Geib. USDA-ARS Pacific Basin Agricultural Research Center, Hilo HI. From Swab to Publication. Madison I. Dunitz. 1. , David A. Coil. 1. , Jenna M. Lang. 1. , Guillaume Jospin. 1. , Aaron E. Darling. 2. , Jonathan A. Eisen. 1. UC Davis Genome Center. 1. University of California, Davis; . Venter et. al (2004). Presented by. Ken . Vittayarukskul. Steven S. White.. Context of the Problem . Evolutionary history is directly tied to microbial genetics. Little is known. Until recently, microbial diversity was measured by PCR amplification and sequencing of only ribosomal genes. Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. How we obtain the sequence of nucleotides of a species. …ACGTGACTGAGGACCGTG. CGACTGAGACTGACTGGGT. CTAGCTAGACTACGTTTTA. TATATATATACGTCGTCGT. ACTGATGACTAGATTACAG. ACTGATTTAGATACCTGAC. TGATTTTAAAAAAATATT…. tens of thousands of DNA bases in length. Fugu is thedraft sequenced after human. Its compact form and sim-sequence. We now have in hand the basic gene-leveldescription of two vertebrates. Compari tens of thousands of DNA bases in length Fugu is thedraft sequenced after human Its compact form and sim-sequence We now have in hand the basic gene-leveldescription of two vertebrates Comparing a Knowing how many genes determine a phenotype (Mendelian and/or QTL analysis), and where the genes are located (linkage mapping) is a first step in understanding the genetic basis of a phenotype . A . Modified from Dan Russell. (Relevant) Trivia. How many base pairs (bp) are there in a human genome?. How many protein coding genes are in the Human genome. How much did it cost to sequence the first human genome?. Tim Graubert, MD. Division of Oncology, Stem Cell Biology Section. Washington University School of Medicine. Siteman Cancer Center. Genome Center at Washington University. Genome Center Leadership. Rick Wilson. for a rare disease Information for patients and family members Genomic Medicine Service What is your genome? Your genome is the information needed to build the human body and keep it healthy. It for suspected cancer Information for patients and family members Genomic Medicine Service NHS What is your genome? Your genome is the information needed to build the human body and keep it health Neisseria. spp.. Gram’s negative Diplococci . Kidney shape with flat opposing edge. Neisseria. spp.. PATHOGENIC:. N. gonorrhoea. (gonococci, G.C) . . Gonorrhoeae. .. N. meningitidis. Lab # 6. NEISSERIA SPECIES. Contains many species; 2 are human pathogens. Neisseria . gonorrhoea. (gonococcus). Neisseria . meningitidis. (. meningococcus. ). Other species are normal flora that inhabit the upper respiratory tract of humans..
Download Document
Here is the link to download the presentation.
"Whole genome sequencing to predict Neisseria"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents
