PPT-Environmental Genome Shotgun Sequencing of the Sargasso Sea

Venter et al 2004 Presented by Ken Vittayarukskul Steven S White Context of the Problem Evolutionary history is directly tied to microbial genetics Little is known Until recently microbial diversity was measured by PCR amplification and sequencing of only ribosomal genes. Shotgun Cache and mynewshotgun.com provide top-notch new and used target and sporting shotguns along with great customer service and support - a combination that can't be beat!  And to see your target more clearly let Susie outfit you with a set of Decot Sport Glasses.  The "Shooters Choice". sequencing . for . identification,. detection, . and control of . Bactrocera dorsalis (. Hendel. ). and other Tephritid pests. Thomas Walk, Scott . Geib. USDA-ARS Pacific Basin Agricultural Research Center, Hilo HI. SHOW ALL. HIDE ALL. A. B. C. D. E. F. G. H. I. Shotgun Cartridge . SHOW ALL. HIDE ALL. B. C. D. E. F. G. H. I. A . cartridge or round packages the bullet, gunpowder, and primer into a single metallic case precisely made to fit the firing chamber of a firearm.. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Dan . Russell. Overview. Prologue: Assembly and Finishing. The Past: Sanger. The Present: Next-Gen (454, . Illumina. , …). The Future: ? (. Nanopore. , . MinION. , Single-molecule). Overview. Prologue: Assembly and Finishing. Stefano . Lise. Bioinformatics & Statistical Genetics (BSG) Core. The . Wellcome. Trust Centre for Human Genetics (WTCHG), Oxford. Email: stefano@well.ox.ac.uk. Outline. Human genetic variation in health and disease. Lenka Veselovská. Laboratory of Developmental Biology and Genomics . Next Generation Sequencing (NGS) . M. odern high-throughput DNA sequencing technologies. parallel, rapid . Decreasing price, time, workflow complexity, error rate. Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. for Colorectal . Cancer. Ulrike (. Riki. ) Peters. Fred Hutchinson Cancer Research Center. University of Washington. Overview. Significance and rationale. . Current efforts on rare and less frequent variants. TexPoint fonts used in EMF: . A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. Lecture 1. Instructor:. David Tse. dntse@stanford.edu. The Genome. …ACGTGACTGAGGACCGTG. CGACTGAGACTGACTGGGT. CTAGCTAGACTACGTTTTA. Knowing how many genes determine a phenotype (Mendelian and/or QTL analysis), and where the genes are located (linkage mapping) is a first step in understanding the genetic basis of a phenotype . A . DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA). DNA cloning – vector (plasmid, BAC), PCR. genome mapping. relative locations of genes are established by following inheritance patterns. for suspected cancer Information for patients and family members Genomic Medicine Service NHS What is your genome? Your genome is the information needed to build the human body and keep it health