PPT-Environmental Genome Shotgun Sequencing of the Sargasso Sea

Author : jane-oiler | Published Date : 2016-12-19

Venter et al 2004 Presented by Ken Vittayarukskul Steven S White Context of the Problem Evolutionary history is directly tied to microbial genetics Little is known

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "Environmental Genome Shotgun Sequencing ..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

Environmental Genome Shotgun Sequencing of the Sargasso Sea: Transcript

Venter et al 2004 Presented by Ken Vittayarukskul Steven S White Context of the Problem Evolutionary history is directly tied to microbial genetics Little is known Until recently microbial diversity was measured by PCR amplification and sequencing of only ribosomal genes. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . From Swab to Publication. Madison I. Dunitz. 1. , David A. Coil. 1. , Jenna M. Lang. 1. , Guillaume Jospin. 1. , Aaron E. Darling. 2. , Jonathan A. Eisen. 1. UC Davis Genome Center. 1. University of California, Davis; . Last lecture summary. recombinant DNA technology. DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA). DNA cloning – vector (plasmid, BAC), PCR. genome mapping. relative locations of genes are established by following inheritance patterns. By Kevin Chen, . Lior. . Pachter. PLoS. Computational Biology, 2005. David Kelley. State of . metagenomics. In July 2005, 9 projects had been completed.. General challenges were becoming apparent. Paper focuses on computational problems. Dan . Russell. Overview. Prologue: Assembly and Finishing. The Past: Sanger. The Present: Next-Gen (454, . Illumina. , …). The Future: ? (. Nanopore. , . MinION. , Single-molecule). Overview. Prologue: Assembly and Finishing. Dan . Russell. The past, present, and future of DNA . sequencing*. Dan . Russell. *DNA sequencing:. D. etermining the number and order of nucleotides that make up a given molecule of DNA.. (Relevant) Trivia. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. How we obtain the sequence of nucleotides of a species. …ACGTGACTGAGGACCGTG. CGACTGAGACTGACTGGGT. CTAGCTAGACTACGTTTTA. TATATATATACGTCGTCGT. ACTGATGACTAGATTACAG. ACTGATTTAGATACCTGAC. TGATTTTAAAAAAATATT…. DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA). DNA cloning – vector (plasmid, BAC), PCR. genome mapping. relative locations of genes are established by following inheritance patterns. Modified from Dan Russell. (Relevant) Trivia. How many base pairs (bp) are there in a human genome?. How many protein coding genes are in the Human genome. How much did it cost to sequence the first human genome?. Whole genome sequencing of babies REASONS FOR USING WHOLE GENOME SEQUENCING IN BABIES There are a number of possible reasons for carrying out whole genome or exome sequencing Seeking a diagnosis for a for suspected cancer Information for patients and family members Genomic Medicine Service NHS What is your genome? Your genome is the information needed to build the human body and keep it health

Download Document

Here is the link to download the presentation.
"Environmental Genome Shotgun Sequencing of the Sargasso Sea"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.