PPT-Genome sequencing and assembly

Author : tatiana-dople | Published Date : 2015-12-05

MayoUIUC Summer C ourse in Computational Biology Session Outline Genome sequencing Schematic overview of genome assembly a DNA is collected from the biological

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "Genome sequencing and assembly" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

Genome sequencing and assembly: Transcript


MayoUIUC Summer C ourse in Computational Biology Session Outline Genome sequencing Schematic overview of genome assembly a DNA is collected from the biological sample and sequenced b The output from the sequencer consists of many billions of short unordered DNA fragments from random positions in the genome c The short fragments are compared with each other to discover how they overlap d The overlap relationships are captured in a large assembly graph shown as nodes representing . sequencing . for . identification,. detection, . and control of . Bactrocera dorsalis (. Hendel. ). and other Tephritid pests. Thomas Walk, Scott . Geib. USDA-ARS Pacific Basin Agricultural Research Center, Hilo HI. From Swab to Publication. Madison I. Dunitz. 1. , David A. Coil. 1. , Jenna M. Lang. 1. , Guillaume Jospin. 1. , Aaron E. Darling. 2. , Jonathan A. Eisen. 1. UC Davis Genome Center. 1. University of California, Davis; . Method to sequence longer regions. cut many times at random (. Shotgun. ). genomic segment. Get one or two reads from each segment. ~500 bp. ~500 bp. Reconstructing the Sequence . (Fragment Assembly). By Kevin Chen, . Lior. . Pachter. PLoS. Computational Biology, 2005. David Kelley. State of . metagenomics. In July 2005, 9 projects had been completed.. General challenges were becoming apparent. Paper focuses on computational problems. Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. (very) large datasets. 5/23/17. Goals for the course. Understand how next-generation sequencing technologies are used in biomedical research. Learn how to use publicly available databases/websites to find specific information about genes. (very) large datasets. 5/24/18. Goals for the course. Understand how next-generation sequencing technologies are used in biomedical research. Learn how to use publicly available databases/websites to find specific information about genes. Purbendra yogi. Introduction. Genome assembly is the process of taking of many short DNA sequences and combine them to form original chromosome.. First generation Assembly began in the late 1980’s and early 1990’s.. Derek M Bickhart . Animal Genomics and Improvement Laboratory . Research Geneticist (Animal) . derek.bickhart@ars.usda.gov . Phone: (301) 504-8679 Fax: (301) 504-8092. USDA disclaimer. Disclaimers: Mention of trade names, commercial products, or companies in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the US Department of Agriculture over others not mentioned. . TexPoint fonts used in EMF: . A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. Lecture 1. Instructor:. David Tse. dntse@stanford.edu. The Genome. …ACGTGACTGAGGACCGTG. CGACTGAGACTGACTGGGT. CTAGCTAGACTACGTTTTA. :. Computational Analysis of the Current State, Bottlenecks and Future Directions. Damla Senol. 1. , Jeremie . Kim. 1,3. , . Saugata Ghose. 1. , Can Alkan. 2. and Onur Mutlu. 3,1. 1 . Department of Electrical and Computer Engineering, Carnegie Mellon University, Pittsburgh, PA, USA. for suspected cancer Information for patients and family members Genomic Medicine Service NHS What is your genome? Your genome is the information needed to build the human body and keep it health . Knowing how many genes determine a phenotype (Mendelian and/or QTL analysis), and where the genes are located (linkage mapping) is a first step in understanding the genetic basis of a phenotype . A second step is determining the sequence of the gene (or genes). and Accurate Assembly Polishing Algorithm. Can Firtina. 1. , Jeremie S. Kim. 1,2. , Mohammed Alser. 1. , . Damla. . Senol. Cali. 2. , A. . Ercument. Cicek. 3. ,. Can Alkan. 3. , and . Onur. Mutlu.

Download Document

Here is the link to download the presentation.
"Genome sequencing and assembly"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents