PPT-Fragment Assembly (in whole-genome shotgun sequencing)

Sequencing and Fragment Assembly AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT 3x10 9 nucleotides Sequence Assembly cut many times at random Shotgun genomic segment. sequencing . for . identification,. detection, . and control of . Bactrocera dorsalis (. Hendel. ). and other Tephritid pests. Thomas Walk, Scott . Geib. USDA-ARS Pacific Basin Agricultural Research Center, Hilo HI. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . From Swab to Publication. Madison I. Dunitz. 1. , David A. Coil. 1. , Jenna M. Lang. 1. , Guillaume Jospin. 1. , Aaron E. Darling. 2. , Jonathan A. Eisen. 1. UC Davis Genome Center. 1. University of California, Davis; . Last lecture summary. recombinant DNA technology. DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA). DNA cloning – vector (plasmid, BAC), PCR. genome mapping. relative locations of genes are established by following inheritance patterns. Method to sequence longer regions. cut many times at random (. Shotgun. ). genomic segment. Get one or two reads from each segment. ~500 bp. ~500 bp. Reconstructing the Sequence . (Fragment Assembly). By Kevin Chen, . Lior. . Pachter. PLoS. Computational Biology, 2005. David Kelley. State of . metagenomics. In July 2005, 9 projects had been completed.. General challenges were becoming apparent. Paper focuses on computational problems. Dan . Russell. The past, present, and future of DNA . sequencing*. Dan . Russell. *DNA sequencing:. D. etermining the number and order of nucleotides that make up a given molecule of DNA.. (Relevant) Trivia. Venter et. al (2004). Presented by. Ken . Vittayarukskul. Steven S. White.. Context of the Problem . Evolutionary history is directly tied to microbial genetics. Little is known. Until recently, microbial diversity was measured by PCR amplification and sequencing of only ribosomal genes. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA). DNA cloning – vector (plasmid, BAC), PCR. genome mapping. relative locations of genes are established by following inheritance patterns. Modified from Dan Russell. (Relevant) Trivia. How many base pairs (bp) are there in a human genome?. How many protein coding genes are in the Human genome. How much did it cost to sequence the first human genome?. 1 David Wishart, Ath3-41 DNA Sequencing 2 Principles of DNA Sequencing PBR322AmpTet DNA fragmentDenature withheat to producessDNAKlenow+ ddNTP+ dNTP+ primers The Secret to Sanger Sequencing 4 Capillar Figure 9.01. PCR Detection of . Sequence Tagged Site. Mapping large genomes requires many . genetic markers. . Those based solely on their unique sequences are known as sequence tagged sites (STS). These unique sequences may be amplified by PCR and mapped relative to each other. In practice, each STS is defined by a pair of specific PCR primers at its ends that generate a PCR fragment of defined length..