PPT-Fragment Assembly (in whole-genome shotgun sequencing)

Sequencing and Fragment Assembly AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT 3x10 9 nucleotides Sequence Assembly cut many times at random Shotgun genomic segment. SHOW ALL. HIDE ALL. A. B. C. D. E. F. G. H. I. Shotgun Cartridge . SHOW ALL. HIDE ALL. B. C. D. E. F. G. H. I. A . cartridge or round packages the bullet, gunpowder, and primer into a single metallic case precisely made to fit the firing chamber of a firearm.. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . From Swab to Publication. Madison I. Dunitz. 1. , David A. Coil. 1. , Jenna M. Lang. 1. , Guillaume Jospin. 1. , Aaron E. Darling. 2. , Jonathan A. Eisen. 1. UC Davis Genome Center. 1. University of California, Davis; . By Kevin Chen, . Lior. . Pachter. PLoS. Computational Biology, 2005. David Kelley. State of . metagenomics. In July 2005, 9 projects had been completed.. General challenges were becoming apparent. Paper focuses on computational problems. INTRODUCTION . The most commonly used technology until a few years ago – BAC. WHOLE GENOME SEQUENCING. ADVANTAGES OF WGS. Utility of next – gen sequence reads . The next-generation platforms are effecting a complete paradigm shift, not only in the organization of large-scale data production, but also in the downstream bioinformatics, IT, and LIMS support required for high data utility and correct interpretation.. Venter et. al (2004). Presented by. Ken . Vittayarukskul. Steven S. White.. Context of the Problem . Evolutionary history is directly tied to microbial genetics. Little is known. Until recently, microbial diversity was measured by PCR amplification and sequencing of only ribosomal genes. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Whole Genome Sequencing for Epidemiologists – A Brief Introduction Joel R Sevinsky , PhD Microbial genomes Common isolate identification techniques using molecular biology Whole genome sequencing (WGS) :. Computational Analysis of the Current State, Bottlenecks and Future Directions. Damla Senol. 1. , Jeremie . Kim. 1,3. , . Saugata Ghose. 1. , Can Alkan. 2. and Onur Mutlu. 3,1. 1 . Department of Electrical and Computer Engineering, Carnegie Mellon University, Pittsburgh, PA, USA. DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA). DNA cloning – vector (plasmid, BAC), PCR. genome mapping. relative locations of genes are established by following inheritance patterns. Modified from Dan Russell. (Relevant) Trivia. How many base pairs (bp) are there in a human genome?. How many protein coding genes are in the Human genome. How much did it cost to sequence the first human genome?. for a rare disease Information for patients and family members Genomic Medicine Service What is your genome? Your genome is the information needed to build the human body and keep it healthy. It Figure 8.01. Sequencing—Fragments of All Possible Lengths. During chain termination or . Sanger sequencing. , the target DNA fragments are copied millions of times, but each copy ends at a different nucleotide position. These subsets of fragments end with a fluorescently-labeled nucleotide that reveal the identity of the final base. The final sequencing data are a series of fluorescent peaks that correspond to the original template . Figure 9.01. PCR Detection of . Sequence Tagged Site. Mapping large genomes requires many . genetic markers. . Those based solely on their unique sequences are known as sequence tagged sites (STS). These unique sequences may be amplified by PCR and mapped relative to each other. In practice, each STS is defined by a pair of specific PCR primers at its ends that generate a PCR fragment of defined length..