PPT-Genome sequencing and assembly

MayoUIUC Summer C ourse in Computational Biology Session Outline Genome sequencing Schematic overview of genome assembly a DNA is collected from the biological sample and sequenced b The output from the sequencer consists of many billions of short unordered DNA fragments from random positions in the genome c The short fragments are compared with each other to discover how they overlap d The overlap relationships are captured in a large assembly graph shown as nodes representing . sequencing . for . identification,. detection, . and control of . Bactrocera dorsalis (. Hendel. ). and other Tephritid pests. Thomas Walk, Scott . Geib. USDA-ARS Pacific Basin Agricultural Research Center, Hilo HI. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . From Swab to Publication. Madison I. Dunitz. 1. , David A. Coil. 1. , Jenna M. Lang. 1. , Guillaume Jospin. 1. , Aaron E. Darling. 2. , Jonathan A. Eisen. 1. UC Davis Genome Center. 1. University of California, Davis; . By Kevin Chen, . Lior. . Pachter. PLoS. Computational Biology, 2005. David Kelley. State of . metagenomics. In July 2005, 9 projects had been completed.. General challenges were becoming apparent. Paper focuses on computational problems. Dan . Russell. The past, present, and future of DNA . sequencing*. Dan . Russell. *DNA sequencing:. D. etermining the number and order of nucleotides that make up a given molecule of DNA.. (Relevant) Trivia. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. School of Engineering. Assembler. Reference. Abyss 1.5.1. Simpson et al., J. T., Wong, K., Jackman, S. D., Schein, J. E., Jones,. . S. J., and . Birol. , I. (2009). Abyss: a parallel assembler for. . Purbendra yogi. Introduction. Genome assembly is the process of taking of many short DNA sequences and combine them to form original chromosome.. First generation Assembly began in the late 1980’s and early 1990’s.. Derek M Bickhart . Animal Genomics and Improvement Laboratory . Research Geneticist (Animal) . derek.bickhart@ars.usda.gov . Phone: (301) 504-8679 Fax: (301) 504-8092. USDA disclaimer. Disclaimers: Mention of trade names, commercial products, or companies in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the US Department of Agriculture over others not mentioned. . How we obtain the sequence of nucleotides of a species. …ACGTGACTGAGGACCGTG. CGACTGAGACTGACTGGGT. CTAGCTAGACTACGTTTTA. TATATATATACGTCGTCGT. ACTGATGACTAGATTACAG. ACTGATTTAGATACCTGAC. TGATTTTAAAAAAATATT…. :. Computational Analysis of the Current State, Bottlenecks and Future Directions. Damla Senol. 1. , Jeremie . Kim. 1,3. , . Saugata Ghose. 1. , Can Alkan. 2. and Onur Mutlu. 3,1. 1 . Department of Electrical and Computer Engineering, Carnegie Mellon University, Pittsburgh, PA, USA. Modified from Dan Russell. (Relevant) Trivia. How many base pairs (bp) are there in a human genome?. How many protein coding genes are in the Human genome. How much did it cost to sequence the first human genome?. and Accurate Assembly Polishing Algorithm. Can Firtina. 1. , Jeremie S. Kim. 1,2. , Mohammed Alser. 1. , . Damla. . Senol. Cali. 2. , A. . Ercument. Cicek. 3. ,. Can Alkan. 3. , and . Onur. Mutlu.