/
DNA Sequencing DNA Sequencing

DNA Sequencing - PowerPoint Presentation

lois-ondreau
lois-ondreau . @lois-ondreau
Follow
396 views
Uploaded On 2016-06-11

DNA Sequencing - PPT Presentation

Method to sequence longer regions cut many times at random Shotgun genomic segment Get one or two reads from each segment 500 bp 500 bp Reconstructing the Sequence Fragment Assembly ID: 357684

contigs reads sequencing genome reads contigs genome sequencing tagattacacagattactga read repeats repeat long merge consensus length fragment tag contig

Share:

Link:

Embed:

Download Presentation from below link

Download Presentation The PPT/PDF document "DNA Sequencing" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.


Presentation Transcript