PPT-Whole Genome Sequencing for Epidemiologists – A

Whole Genome Sequencing for Epidemiologists A Brief Introduction Joel R Sevinsky PhD Microbial genomes Common isolate identification techniques using molecular biology Whole genome sequencing WGS. What is Whole Disk Encr yp tion Whole Disk Encr yp tion versus File Encr yp tion Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Venter et. al (2004). Presented by. Ken . Vittayarukskul. Steven S. White.. Context of the Problem . Evolutionary history is directly tied to microbial genetics. Little is known. Until recently, microbial diversity was measured by PCR amplification and sequencing of only ribosomal genes. Timetable for today. Time. Activity. 00:00. Introduction to the session. 00:10. Story cards . 00:20. Info cards. 00:30. Issue cards. 00:40. Discuss two key. issues. 00:45. Feedback your issues. What is DNA?. Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. (very) large datasets. 5/23/17. Goals for the course. Understand how next-generation sequencing technologies are used in biomedical research. Learn how to use publicly available databases/websites to find specific information about genes. Knowing how many genes determine a phenotype (Mendelian and/or QTL analysis), and where the genes are located (linkage mapping) is a first step in understanding the genetic basis of a phenotype . A . Tim Graubert, MD. Division of Oncology, Stem Cell Biology Section. Washington University School of Medicine. Siteman Cancer Center. Genome Center at Washington University. Genome Center Leadership. Rick Wilson. . In the paper, researchers describe the final product of the Human Genome Project, which was the 13year effort to read the information encoded in the human chromosomes that reached its culmination i Whole genome sequencing of babies REASONS FOR USING WHOLE GENOME SEQUENCING IN BABIES There are a number of possible reasons for carrying out whole genome or exome sequencing Seeking a diagnosis for a T – Its History and Advancements into New Research and Technology Jutta Marzillier , Ph.D Lehigh University Biological Sciences September 5 th , 2014 Objectives Techniques that enabled genome sequ . Knowing how many genes determine a phenotype (Mendelian and/or QTL analysis), and where the genes are located (linkage mapping) is a first step in understanding the genetic basis of a phenotype . A second step is determining the sequence of the gene (or genes). Vince Buonaccorsi. Juniata College. Cost of sequencing. https://www.genome.gov/about-genomics/fact-sheets/Sequencing-Human-Genome-cost. Next (2. nd. ) Generation Sequencing. How does Illumina sequencing work?.