PPT-Bioinformatics for Whole-Genome Shotgun Sequencing of Micro
Author : myesha-ticknor | Published Date : 2016-06-11
By Kevin Chen Lior Pachter PLoS Computational Biology 2005 David Kelley State of metagenomics In July 2005 9 projects had been completed General challenges were
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Bioinformatics for Whole-Genome Shotgun ..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Bioinformatics for Whole-Genome Shotgun Sequencing of Micro: Transcript
By Kevin Chen Lior Pachter PLoS Computational Biology 2005 David Kelley State of metagenomics In July 2005 9 projects had been completed General challenges were becoming apparent Paper focuses on computational problems. From Swab to Publication. Madison I. Dunitz. 1. , David A. Coil. 1. , Jenna M. Lang. 1. , Guillaume Jospin. 1. , Aaron E. Darling. 2. , Jonathan A. Eisen. 1. UC Davis Genome Center. 1. University of California, Davis; . Last lecture summary. recombinant DNA technology. DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA). DNA cloning – vector (plasmid, BAC), PCR. genome mapping. relative locations of genes are established by following inheritance patterns. Dan . Russell. Overview. Prologue: Assembly and Finishing. The Past: Sanger. The Present: Next-Gen (454, . Illumina. , …). The Future: ? (. Nanopore. , . MinION. , Single-molecule). Overview. Prologue: Assembly and Finishing. Dan . Russell. The past, present, and future of DNA . sequencing*. Dan . Russell. *DNA sequencing:. D. etermining the number and order of nucleotides that make up a given molecule of DNA.. (Relevant) Trivia. Venter et. al (2004). Presented by. Ken . Vittayarukskul. Steven S. White.. Context of the Problem . Evolutionary history is directly tied to microbial genetics. Little is known. Until recently, microbial diversity was measured by PCR amplification and sequencing of only ribosomal genes. Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA). DNA cloning – vector (plasmid, BAC), PCR. genome mapping. relative locations of genes are established by following inheritance patterns. Adapted . from:. http. ://. ase.tufts.edu/chemistry/walt/sepa/geneticsofrace.html. Uploaded: January 8, 2017. Genetics of Race. Lesson 1: . Introduction. Goals:. Introduce module topic . Provide necessary background. Modified from Dan Russell. (Relevant) Trivia. How many base pairs (bp) are there in a human genome?. How many protein coding genes are in the Human genome. How much did it cost to sequence the first human genome?. Dr. Ronald Moura. ronaldmoura1989@gmail.com. https://www.linkedin.com/in/ronald-moura-660017178. /. Gordon Moore . “The . number of transistors in a dense integrated circuit doubles about every two . computer science, mathematics, information technology and statistics. to analyze the biological data like . genomics, Protein structure prediction, . Pharmaco-phore. modeling , toxicity prediction and drug designing.. DNA - the basics. Drew Berry – DNA animations. http://. www.youtube.com. /. watch?v. =. WFCvkkDSfIU&index. =4&list=PL9CBBEA5A85DBCDEF. Organisation of DNA. DNA is packed in Chromosomes . Karyotype: chromosome set of a species . Whole genome sequencing of babies REASONS FOR USING WHOLE GENOME SEQUENCING IN BABIES There are a number of possible reasons for carrying out whole genome or exome sequencing Seeking a diagnosis for a Petrus Tang, Ph.D. (. 鄧致剛. ). Graduate Institute of Basic Medical Sciences. and. Bioinformatics Center, Chang Gung University. .. petang@mail.cgu.edu.tw. EXT: . 5136. 助教:. 蔡智宇. (. 分機.
Download Document
Here is the link to download the presentation.
"Bioinformatics for Whole-Genome Shotgun Sequencing of Micro"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents