PPT-Bioinformatics for Whole-Genome Shotgun Sequencing of Micro

By Kevin Chen Lior Pachter PLoS Computational Biology 2005 David Kelley State of metagenomics In July 2005 9 projects had been completed General challenges were becoming apparent Paper focuses on computational problems. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Dan . Russell. Overview. Prologue: Assembly and Finishing. The Past: Sanger. The Present: Next-Gen (454, . Illumina. , …). The Future: ? (. Nanopore. , . MinION. , Single-molecule). Overview. Prologue: Assembly and Finishing. Venter et. al (2004). Presented by. Ken . Vittayarukskul. Steven S. White.. Context of the Problem . Evolutionary history is directly tied to microbial genetics. Little is known. Until recently, microbial diversity was measured by PCR amplification and sequencing of only ribosomal genes. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. High-throughput Data Analysis. Literature Study. Data Mining . Functional Genomics Analysis. Vector NTI Advance®. Software. License type. License number. 2008. 2009. 2010. 2011. 2012. 2013. 2014. Galaxy. Whole Genome Sequencing for Epidemiologists – A Brief Introduction Joel R Sevinsky , PhD Microbial genomes Common isolate identification techniques using molecular biology Whole genome sequencing (WGS) Section 1: Introduction and biological databases.. Section 2: Sequence alignment.. Section 3: Gene and promoter prediction.. Section 4: Molecular phylogenetics.. Section 5: Structural Bioinformatics. Adapted . from:. http. ://. ase.tufts.edu/chemistry/walt/sepa/geneticsofrace.html. Uploaded: January 8, 2017. Genetics of Race. Lesson 1: . Introduction. Goals:. Introduce module topic . Provide necessary background. Dr. Ronald Moura. ronaldmoura1989@gmail.com. https://www.linkedin.com/in/ronald-moura-660017178. /. Gordon Moore . “The . number of transistors in a dense integrated circuit doubles about every two . DNA - the basics. Drew Berry – DNA animations. http://. www.youtube.com. /. watch?v. =. WFCvkkDSfIU&index. =4&list=PL9CBBEA5A85DBCDEF. Organisation of DNA. DNA is packed in Chromosomes . Karyotype: chromosome set of a species . Whole genome sequencing of babies REASONS FOR USING WHOLE GENOME SEQUENCING IN BABIES There are a number of possible reasons for carrying out whole genome or exome sequencing Seeking a diagnosis for a for a rare disease Information for patients and family members Genomic Medicine Service What is your genome? Your genome is the information needed to build the human body and keep it healthy. It Petrus Tang, Ph.D. (. 鄧致剛. ). Graduate Institute of Basic Medical Sciences. and. Bioinformatics Center, Chang Gung University. .. petang@mail.cgu.edu.tw. EXT: . 5136. 助教：. 蔡智宇. (. 分機.