PDF-Shotgun sequencing

Author : karlyn-bohler | Published Date : 2015-10-19

Sanger DNA sequencing as you may guess only works primer best from about 30 nt to 350 nt the

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "Shotgun sequencing" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

Shotgun sequencing: Transcript


Sanger DNA sequencing as you may guess only works primer best from about 30 nt to 350 nt the. Municipal Police Training Committee. Firearms Advisory Group. Shotgun Instructor Module. Revised . April 2012. Authors. Chief Bert DuVernay – New Braintree PD chief@newbraintree.org. Off. Todd Bailey – Kingston PD tabailey@mlefiaa.org. “. gunfight at the Angel Hotel. ”. A bunch of rowdy Cowboys from the Jackson Hole Gang are havin breakfast in Dancin Angel’s dining room at the Angel Hotel. An argument breaks out between Big Whisky and Timber Creek Cowboy. They pull their shootin irons and start shootin up the place. Displayed in the dining room cupboard are Dancin Angel’s favorite china plates. As bullets are a flying she yells “Don’t Break My Plates” she grabs her scatter gun and sends them boys a runnin into the street.. Last lecture summary. recombinant DNA technology. DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA). DNA cloning – vector (plasmid, BAC), PCR. genome mapping. relative locations of genes are established by following inheritance patterns. 180 Degree Rule Review . http://www.youtube.com/watch?v=. HdyyuqmCW14. Montage Definitions . Soviet montage. theory is an approach to understanding and creating cinema that relies heavily upon . editing. Venter et. al (2004). Presented by. Ken . Vittayarukskul. Steven S. White.. Context of the Problem . Evolutionary history is directly tied to microbial genetics. Little is known. Until recently, microbial diversity was measured by PCR amplification and sequencing of only ribosomal genes. (Hopefully). By. And . KochLab. This presentation will include . amazing topics like:. The Latest in Tweezers Technology. Biological Advancements. And more…. Thank You!. KochLab. Guys. Steve Koch – Lab Don. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . related. What is hunting actually? . Many of us associate this occupation only with killing innocent animals.. In reality. shooting. the game. is . the last activity which takes place in the long chain of different tasks included in . (Hopefully). By. And . KochLab. This presentation will include . amazing topics like:. The Latest in Tweezers Technology. Biological Advancements. And more…. Thank You!. KochLab. Guys. Steve Koch – Lab Don. Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. How we obtain the sequence of nucleotides of a species. …ACGTGACTGAGGACCGTG. CGACTGAGACTGACTGGGT. CTAGCTAGACTACGTTTTA. TATATATATACGTCGTCGT. ACTGATGACTAGATTACAG. ACTGATTTAGATACCTGAC. TGATTTTAAAAAAATATT…. DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA). DNA cloning – vector (plasmid, BAC), PCR. genome mapping. relative locations of genes are established by following inheritance patterns. Modified from Dan Russell. (Relevant) Trivia. How many base pairs (bp) are there in a human genome?. How many protein coding genes are in the Human genome. How much did it cost to sequence the first human genome?. 1. NO LIVE AMMUNITION . in the classroom. NO EXCEPTIONS!. Orientation Goal. To provide beginning shooters with the knowledge, skills, and attitude necessary to shoot a shotgun safely under the direct supervision of a NRA Certified Shotgun Instructor or a Certified NCS Shooting Sports Director..

Download Document

Here is the link to download the presentation.
"Shotgun sequencing"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents