Illumina uses photocleavable fluorescent nucleotides and terminators for DNA Sequencing Both groups are cleaved off after recording fluorescence of incorporated nucleotide Each nucleotide dATP dTTP dGTP or dCTP have a different fluorescent group ID: 1044481
Download Presentation The PPT/PDF document "STEP 3: THE ACTUAL SEQUENCING PART" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
![NGS: Next-Generation [high throughput] Sequencing I: Background](https://thumbs.docslides.com/702160/ngs-next-generation-high-throughput-sequencing-i-background.jpg)
1. STEP 3: THE ACTUAL SEQUENCING PARTIllumina uses photo-cleavable fluorescent nucleotides and terminators for DNA Sequencing Both groups are cleaved off after recording fluorescence of incorporated nucleotideEach nucleotide (dATP, dTTP, dGTP, or dCTP) have a different fluorescent group, emitting fluorescence of different wave lengths upon excitation.All four nucleotides are added in each cycle, nucleotides that are not incorporated are washed off before recording fluorescence of incorporated nucleotides.Example of fluorescent group3’ OH blocking groupLast base added to growing chainColorless chain now ready for next base addition
2. Sequencing is done as new DNA is made:We use a primer that recognizes one of the adaptor sequences (want to sequence forward and reverse strands separately)The DNA is made and detected one nucleotide at a timeEach nucleotide has a different fluorescent tag on it that both fluoresces and terminates synthesisA computer reads the colour of fluorescence of each spot (up to 3.2 billion spots per experiment!)Then the fluorescence is cleaved off, so synthesis can continueWhat the computer “sees” for four cycles of illumina sequencing
3. Illumina sequencingCyclic reversible termination A DNA polymerase, bound to the primed template incorporates one fluorescently modified nucleotide (the complement of the template base) 2. Remaining unincorporated nucleotides are washed away. 3. Excitation of fluorophore and imaging of fluorescence is done to determine the identity of the incorporated nucleotide. 4. A cleavage step removes the terminating/inhibiting group and the fluorescent dye5. Additional washing is performed 6. Steps 1-5 are repeated over againEach strand represents one clonal cluster
4. 5’5’3’5’3’3’5’5’3’3’5’3’AB5’3’Paired-end sequencingBridge amplification generatesclusters with ½ population sense, ½ population antisense strandsOne end of fragment can be sequencedusing primer matching the 3’ end of the sense strandOther end can be sequenced usingprimer matching the 3’ end of theantisense strand (separately)The reverse complementary sequenceof the antisense constitute a “gapped”continuation of the sense strand sequenceATGCGGCCATGCGGGGAAAT…………………….…..TGTGCGTCATGAACGATGCC100 100 100
5. Next Generation Sequencing Technologies+ Avoids labor-intensive cloning in plasmid/individual DNA preps and individual sequencing reactions+ Massive parallel processing of templates/sequencing reactions Reads are short: - too short for complete sequencing of complex genomes - used primarily for re-sequencing of genomes (such as thousands of human genomes)[ASSEMBLY DONE BY COMPUTER] Can read length be extended?