PPT-Fig S1: Segmental duplication of each chromosome of soybean. Length of segment (not to
Author : dandy | Published Date : 2024-01-29
colour direct duplication in red colour reverse duplication Glyma09G211400 Glyma09G199800 Glyma01G009600 Glyma01G022500 Glyma02G041500 Glyma02G018900 Glyma03G067000
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Fig S1: Segmental duplication of each ch..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Fig S1: Segmental duplication of each chromosome of soybean. Length of segment (not to: Transcript
colour direct duplication in red colour reverse duplication Glyma09G211400 Glyma09G199800 Glyma01G009600 Glyma01G022500 Glyma02G041500 Glyma02G018900 Glyma03G067000 Glyma03G070900. ON . SEGMENTAL CONSTRUCTION . OF BRIDGE. Guided by: Submitted by:. Dr. M.K SHRIMALI Gaurav Jhalani. Dr. S.D. BHARTI . ▽. tggttgtttccaccttttgg. atgcatagtcacctttttga. ▲. gtagcttttgtatgttaggc. …981Ns…. g. aggagcagtgcttccacac. ▲. tctgaggcggaacatggtggcgcctttctttgcaggggtggctatgtagaga. ▽. agttgtcctggacacttcca. atgtatcataatttatctcttcacctcctgtagggcatct. Numerical Abnormalities . . Structural Abnormalities . Numerical Abnormalities . Gains and losses of whole chromosomes in the karyotype string are usually denoted by the use of either a plus ( ) or minus (−) sign before the aberrant chromosome; for example, . All scale drawings . must . have a scale written on them. Scales are usually expressed as ratios.. Normally for maps and buildings the ratio:. Drawing length: Actual length. For maps the ratio is normally in the ratio:. did Cyclops from the X-Men get his . superpowers. ?. He was born with the mutation. How did the Hulk and Spiderman get their . superpowers. ?. The Hulk was exposed to . g. amma radiation and Spiderman was bitten by a radioactive spider . OF BRIDGE. Guided by: Submitted by:. Dr. M.K SHRIMALI Gaurav Jhalani. Dr. S.D. BHARTI . 2010PST111. Structural Engineering M.Tech III. Measuring Segments. Students will be able . to:. Measure . and compare lengths of . segments using ruler. . . . Key Vocabulary. Line Segment. Distance/length. congruent segments. Segment bisector. 6c. Chromosome Mutations. Learning Intentions. By the end of this topic you should be able to:. (c) Chromosome structure mutations. Define ‘chromosome structure mutation’ . Name 4 chromosome structure mutations . Warm Up. Solve the proportions for x.. 2. . 4. . 5. . 6. . . In Pete’s blueprint the length of a side wall is 16 inches. . . Find the . actual length . of the wall. .. The back wall of the house is 33 feet long. . Yuvaraja’s College. University of Mysore, Mysore. 11 September 2020. 1. www.hbmahesh.weebly.com. Chromosomes . have definite . structure and organization, which is normally constant from one cell division to next. . Bump in the Road. Write down something you found. confusing from material covered . yesterday.. Properties of Dilations. Module 3. LP2. Example 1: Dilating a segment. D. ilate . with a scale factor . disorders- common cause of diseases, prolonged handicap and death in human.. 1% newborns have monogenic diseases like. CF, SCD etc.. . 0.5% have . chr. . disorders like Down Synd.. DISCLAIMER: • The presentation includes images which are taken from Google images or books . • They are being used in the presentation only for educational purpose . • The author of the presenta Typically occur during meiosis (gamete formation) but can also occur during mitosis. Can lead to cancer some cases. We will look at: Translocation, Deletion, Duplication and Inversion. Few harmful gene mutations are passed on to the next generation because the zygote usually dies. If it lives, the offspring may have birth defects..
Download Document
Here is the link to download the presentation.
"Fig S1: Segmental duplication of each chromosome of soybean. Length of segment (not to"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents