PDF-NITROGEN FERTILITY AND PERFORMANCE OF HULLESS AND HULLED BARLEY Bill B

Author : giovanna-bartolotta | Published Date : 2017-01-08

causedplantHigh varietiesidentifyingtoNN than wereeffectdesignreplicationstreatmentsvarietieslinesappliedidentifyingvarietieslinesmaximizediversityusingvarietieslinessharedetermineanyachievemax

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "NITROGEN FERTILITY AND PERFORMANCE OF HU..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

NITROGEN FERTILITY AND PERFORMANCE OF HULLESS AND HULLED BARLEY Bill B: Transcript


causedplantHigh varietiesidentifyingtoNN than wereeffectdesignreplicationstreatmentsvarietieslinesappliedidentifyingvarietieslinesmaximizediversityusingvarietieslinessharedetermineanyachievemax. S Barley is the worlds oldest grain as evidenced by discoveries in ancient cities in the Mideast and North Africa It has been cultivate d for about 8000 years and today is the worlds fourth largest cereal crop Ba rley as a food is most commonly ident Chris Burke. Farmers Forum Roadshow April 2015. A miracle happens. Feed her grain. Cow calves. Cow is more fertile. How could grain help?. S. tarch. G. lucose. Insulin-like Growth Factor 1(IGF-1). Insulin. Chromosome mapping by recombination . Meiosis is the basis of transmission genetics. The recombination that occurs during meiosis (in heterozygotes) generates data that are a useful tool for making linkage maps. Barley grain comes off the plant in two S. Padulosi,K. Hammer HULLED WHEATS M. Nesbitt and D. SamuelInstitute of Archaeology, University College London, London, EnglandMcDonald Institute for Archaeological Research, University of Cambridge, USGC IMC & Member Meeting. Charleston, SC. U.S. GRAINS COUNCIL . Scott Brown. President. National Barley Growers Association. Who We Are. 2. Formed in 1989, the . NBGA is a . grassroots policy advocacy . Global and local considerations. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). Global and local considerations. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). . Thursday . June 29, 2017. Building 615, Agronomy Experiment Station. Stillwater, OK 74078. Agenda. 11:30 am Convene at the Soil Fertility Shop, Lunch will be served. 12:00 Opening Remarks, Dr. Brian Arnall. Taketa PNAS 2008. Hulled phenotype controlled by one gene: NUD. >NUD_CDS. ATGGTACAGTCCAAGAAGAAGTTTCGCGGCGTCAGGCAGCGCCACTGGGGCTCCTGGGTCTCCGAGATCAGGCATCCTCTCCTAAGAGGAGGGTGTGGTTGGGCACCTTTGAGACGGCGGAGGAGGCTGCGCGGGCGTACGATGAGGCTGCCATCCTGATGAGCGGGCGCAACGCCAAGACCAACTTCCCCGTACCGAGGAGTGCCAACGGGGAGATCATCGTCGCCCCAGCAGCAGCAGCACGGGACATTCGCGGTGGCGTTGGCTCGTCGTCCTCCGGGGCCGCCGGCGCCAGCAGCCTGTCACAGATCCTCAGCGCCAAGCTCCGCAAGTGCTGCAAGACACCGTCCCCGTCCCTCACCTGCCTCCGCCTCGACACCGAGAAGTCCCACATTGGCGTCTGGCAGAAGCGCGCGGGTGCCCGTGCCGACTCCAGCTGGGTCATGACCGTCGAGCTCAACAAGGAGCCGGCCGCAGCGGCACCACCAACGCCCAGCGACAGCACGGTGTCGGCGACTCCTTCCTCGTCCACGTCCACGTCCACAACGGGCTCCCCACCGGAGGCAATGGAGGACGAAGAGAGGATCGCGCTGCAGATGATAGAGGAGCTGCTGAGCAGGAGCAGCCCGGCTTCGCCGTCACATGGGCTGCTGCACGGTGAAGAAGGCAGCCTCCTCATCTGA. 5.3 . Gbp. . ~ 30,000 genes. Self-pollinated (hermaphroditic). Inflorescence type. 2-row vs. 6-row. 1 gene/30,000 genes. . Covered vs. Naked . 1 gene/30,000 genes. Growth Habit. Winter, facultative and spring. Barley is a member of the . Gramineae. family.. In Ireland Barley is grown in two forms. Feeding barley is used as an animal feed.. Malting barley is used for malting and brewing alcohol.. Barley is easily distinguished from other cereals by the awns present on the grain. irrigated . ABI Voyager in Montana.. ABI Voyager. The following agronomic, yield and quality, pathology and botanical information on ABI Voyager is based on the best available data (Global Barley Research, SmartBarley, and University of Idaho). However, it is up to each farmer to interpret the validity of the contained information and assess how it relates to their own barley growing operations.. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). In the beginning there was spontaneity: .

Download Document

Here is the link to download the presentation.
"NITROGEN FERTILITY AND PERFORMANCE OF HULLESS AND HULLED BARLEY Bill B"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents