PPT-Oregon Barley Variety Development and Deployment
Author : alexa-scheidler | Published Date : 2018-02-10
Facultative growth habit Fall planting Cold tolerance o n demand Spring planting Cold tolerance n ot needed Objective 1 Fallplanted winter and facultative
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Oregon Barley Variety Development and De..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Oregon Barley Variety Development and Deployment: Transcript
Facultative growth habit Fall planting Cold tolerance o n demand Spring planting Cold tolerance n ot needed Objective 1 Fallplanted winter and facultative variety development and . coukfood Veal cutlet marinated in barley miso ginger and yuzu with burnt chili cucumber pickle Ingredients For the barley miso marinade 3 tbsp barley miso 3 tbsp finely chopped fresh root ginger 3 tbsp finely diced y The Or egon Coast Coastal Cutthroat Tr out SMU passed all six interim criteria and its conservation risk classification for this Status Report is not at risk Existing Populations The Oregon Coast Coastal Cutthroat Trout SMU is comprised in this re p Patrick Hayes. Dept. Crop and Soil Science. Oregon State University. Corvallis, Oregon USA. www.barleyworld.org. What barley was. What barley is. What barley could be . First crop domesticated (?) . Beer . . Crop. LIFE12 ENV/IT/000356. 01/01/2014-31/12/2015. Barley. . Crop. Photo. 1. . Barley. . crop. 30/03/2015. Barley. . Crop. Photo. 2. . Barley. . crop. 30/03/2015. Barley. . Crop. Photo. Global and local considerations. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). Source: CMBTC. Source: CMBTC. Source: CMBTC. Source: CGC. Source: CGC. Region. 2011. 2012. 2013. 2014. 2015. Western. Canada. 7,432.0. 7,488.8. 9,748.3. 6,853.6. 7,199.5. Eastern Canada. 459.5. 523.5. Global and local considerations. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). YAVA Sridhar Reddy 1. PG Scholar, Dept of PG studies in Ayurveda Siddhanta, GAMC 2. PG Scholar, Dept of PG studies in Ayurveda Siddhanta, GAMC Mysore, Karnataka, India. 3. Lecturer, Dept of PG stu Taketa PNAS 2008. Hulled phenotype controlled by one gene: NUD. >NUD_CDS. ATGGTACAGTCCAAGAAGAAGTTTCGCGGCGTCAGGCAGCGCCACTGGGGCTCCTGGGTCTCCGAGATCAGGCATCCTCTCCTAAGAGGAGGGTGTGGTTGGGCACCTTTGAGACGGCGGAGGAGGCTGCGCGGGCGTACGATGAGGCTGCCATCCTGATGAGCGGGCGCAACGCCAAGACCAACTTCCCCGTACCGAGGAGTGCCAACGGGGAGATCATCGTCGCCCCAGCAGCAGCAGCACGGGACATTCGCGGTGGCGTTGGCTCGTCGTCCTCCGGGGCCGCCGGCGCCAGCAGCCTGTCACAGATCCTCAGCGCCAAGCTCCGCAAGTGCTGCAAGACACCGTCCCCGTCCCTCACCTGCCTCCGCCTCGACACCGAGAAGTCCCACATTGGCGTCTGGCAGAAGCGCGCGGGTGCCCGTGCCGACTCCAGCTGGGTCATGACCGTCGAGCTCAACAAGGAGCCGGCCGCAGCGGCACCACCAACGCCCAGCGACAGCACGGTGTCGGCGACTCCTTCCTCGTCCACGTCCACGTCCACAACGGGCTCCCCACCGGAGGCAATGGAGGACGAAGAGAGGATCGCGCTGCAGATGATAGAGGAGCTGCTGAGCAGGAGCAGCCCGGCTTCGCCGTCACATGGGCTGCTGCACGGTGAAGAAGGCAGCCTCCTCATCTGA. kindly visit us at www.examsdump.com. Prepare your certification exams with real time Certification Questions & Answers verified by experienced professionals! We make your certification journey easier as we provide you learning materials to help you to pass your exams from the first try. Professionally researched by Certified Trainers,our preparation materials contribute to industryshighest-99.6% pass rate among our customers. kindly visit us at www.examsdump.com. Prepare your certification exams with real time Certification Questions & Answers verified by experienced professionals! We make your certification journey easier as we provide you learning materials to help you to pass your exams from the first try. Professionally researched by Certified Trainers,our preparation materials contribute to industryshighest-99.6% pass rate among our customers. Bradbury et al. . fgr. (Bad2) . DNA sequences . identical . for. . fragrant rice accessions . DNA sequences . identical. for non-fragrant accessions . DNA sequences . different. between fragrant and non-fragrant accessions. Barley is a member of the . Gramineae. family.. In Ireland Barley is grown in two forms. Feeding barley is used as an animal feed.. Malting barley is used for malting and brewing alcohol.. Barley is easily distinguished from other cereals by the awns present on the grain. introgressing. . rpg4/rpg5. into TTKSK- susceptible germplasm . Department of Crop and Soil Science. Javier Hernandez. Phd. student. Patrick Hayes. Professor . Barley project. Oregon State University.
Download Document
         Here is the link to download the presentation.
"Oregon Barley Variety Development and Deployment"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
	 
        
Related Documents

 
         
         
         
         
         
         
         
         
         
         
         
         
        