PPT-Barley to Block:
Author : olivia-moreira | Published Date : 2017-08-16
Global and local considerations Why Barley How Malting Who Barley Research Production and Processing Whats next naked barley Random bits of science and technology
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Barley to Block:" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Barley to Block:: Transcript
Global and local considerations Why Barley How Malting Who Barley Research Production and Processing Whats next naked barley Random bits of science and technology Tap Talk 1 Why Barley. S Barley is the worlds oldest grain as evidenced by discoveries in ancient cities in the Mideast and North Africa It has been cultivate d for about 8000 years and today is the worlds fourth largest cereal crop Ba rley as a food is most commonly ident Patrick Hayes. Dept. Crop and Soil Science. Oregon State University. Corvallis, Oregon USA. www.barleyworld.org. What barley was. What barley is. What barley could be . First crop domesticated (?) . Beer . Update. Barley Supply & Demand Table. . U.S.. Barley. 2010/2011(Est.). 2011/2012(Feb). 2011/2012(Mar). Planted A.. 2.87. . Mill. A.. 2.56 Mill. A.. 2.56 Mill. A.. Harvested A.. 2.47 Mill. A.. 2.24 Mill. A.. . Crop. LIFE12 ENV/IT/000356. 01/01/2014-31/12/2015. Barley. . Crop. Photo. 1. . Barley. . crop. 30/03/2015. Barley. . Crop. Photo. 2. . Barley. . crop. 30/03/2015. Barley. . Crop. Photo. Source: CMBTC. Source: CMBTC. Source: CMBTC. Source: CGC. Source: CGC. Region. 2011. 2012. 2013. 2014. 2015. Western. Canada. 7,432.0. 7,488.8. 9,748.3. 6,853.6. 7,199.5. Eastern Canada. 459.5. 523.5. Global and local considerations. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). http://www.lincfoods.com/malt. /. http://www.meccagrade.com. /. http://. barleyworld.org/malt-house. Barley contributes to beer flavor. The Flavor 7-Pack. Bells, Deschutes, Firestone-Walker New Glarus, . Facultative . growth habit . . Fall planting. Cold tolerance. o. n demand . Spring planting. Cold tolerance . n. ot needed . Objective 1 – Fall-planted winter and facultative variety development and . Taketa PNAS 2008. Hulled phenotype controlled by one gene: NUD. >NUD_CDS. ATGGTACAGTCCAAGAAGAAGTTTCGCGGCGTCAGGCAGCGCCACTGGGGCTCCTGGGTCTCCGAGATCAGGCATCCTCTCCTAAGAGGAGGGTGTGGTTGGGCACCTTTGAGACGGCGGAGGAGGCTGCGCGGGCGTACGATGAGGCTGCCATCCTGATGAGCGGGCGCAACGCCAAGACCAACTTCCCCGTACCGAGGAGTGCCAACGGGGAGATCATCGTCGCCCCAGCAGCAGCAGCACGGGACATTCGCGGTGGCGTTGGCTCGTCGTCCTCCGGGGCCGCCGGCGCCAGCAGCCTGTCACAGATCCTCAGCGCCAAGCTCCGCAAGTGCTGCAAGACACCGTCCCCGTCCCTCACCTGCCTCCGCCTCGACACCGAGAAGTCCCACATTGGCGTCTGGCAGAAGCGCGCGGGTGCCCGTGCCGACTCCAGCTGGGTCATGACCGTCGAGCTCAACAAGGAGCCGGCCGCAGCGGCACCACCAACGCCCAGCGACAGCACGGTGTCGGCGACTCCTTCCTCGTCCACGTCCACGTCCACAACGGGCTCCCCACCGGAGGCAATGGAGGACGAAGAGAGGATCGCGCTGCAGATGATAGAGGAGCTGCTGAGCAGGAGCAGCCCGGCTTCGCCGTCACATGGGCTGCTGCACGGTGAAGAAGGCAGCCTCCTCATCTGA. :. farming barley in . the UK. ;. the process of malting;. barley . in our . diet;. f. ood and drink made from barley and malt.. Farming barley. Barley is grown on about 1.2 million hectares of land in the UK. . 5.3 . Gbp. . ~ 30,000 genes. Self-pollinated (hermaphroditic). Inflorescence type. 2-row vs. 6-row. 1 gene/30,000 genes. . Covered vs. Naked . 1 gene/30,000 genes. Growth Habit. Winter, facultative and spring. Bradbury et al. . fgr. (Bad2) . DNA sequences . identical . for. . fragrant rice accessions . DNA sequences . identical. for non-fragrant accessions . DNA sequences . different. between fragrant and non-fragrant accessions. Barley is a member of the . Gramineae. family.. In Ireland Barley is grown in two forms. Feeding barley is used as an animal feed.. Malting barley is used for malting and brewing alcohol.. Barley is easily distinguished from other cereals by the awns present on the grain. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). In the beginning there was spontaneity: .
Download Document
Here is the link to download the presentation.
"Barley to Block:"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents