PPT-Barley – Molecular Breeding
Author : trish-goza | Published Date : 2017-05-30
IAMZ 2015 Patrick Hayes Dept Crop and Soil Science Oregon State University Corvallis Oregon USA wwwbarleyworldorg Class Outline General considerations for molecular
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Barley – Molecular Breeding" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Barley – Molecular Breeding: Transcript
IAMZ 2015 Patrick Hayes Dept Crop and Soil Science Oregon State University Corvallis Oregon USA wwwbarleyworldorg Class Outline General considerations for molecular breeding Selection tools and molecular breeding . – so many options. Impacts of . Ploidy. Changes. Changes in chromosome number and structure can have major health impacts e.g. trisomy 21. Polyploidy in cultivated and domesticated plants is widespread and of evolutionary and economic importance. Patrick Hayes. Dept. Crop and Soil Science. Oregon State University. Corvallis, Oregon USA. www.barleyworld.org. What barley was. What barley is. What barley could be . First crop domesticated (?) . Beer . Classic Breeding. Main Street. Molecular . breeding. Abiotic and biotic resistance breeding . (. disease/pest resistance, . drought and salt tolerance). Parent selection and progeny testing. Marker-assisted selection (MAS). ABSTRACT: . Barley is . among the major . food . security . crops . in the highlands and . industrial commodity . for the emerging brewery industry. This paper documents the current productivity levels, varietal adoption and seed commercial . YAVA Sridhar Reddy 1. PG Scholar, Dept of PG studies in Ayurveda Siddhanta, GAMC 2. PG Scholar, Dept of PG studies in Ayurveda Siddhanta, GAMC Mysore, Karnataka, India. 3. Lecturer, Dept of PG stu The global molecular diagnostics market was worth USD 15.29 billion in 2020 and is further projected to reach USD 31.98 billion by 2027, at a CAGR of 11.1% during the forecast period (2021-2027). in the northern region: Land Product Photo Producer link Norway Prebaked pizzabun s Duga AS http://duga.no/produkter/ Norway Half cooked buns Duga AS http://duga.no/produkter/ Norway Precooked pita Taketa PNAS 2008. Hulled phenotype controlled by one gene: NUD. >NUD_CDS. ATGGTACAGTCCAAGAAGAAGTTTCGCGGCGTCAGGCAGCGCCACTGGGGCTCCTGGGTCTCCGAGATCAGGCATCCTCTCCTAAGAGGAGGGTGTGGTTGGGCACCTTTGAGACGGCGGAGGAGGCTGCGCGGGCGTACGATGAGGCTGCCATCCTGATGAGCGGGCGCAACGCCAAGACCAACTTCCCCGTACCGAGGAGTGCCAACGGGGAGATCATCGTCGCCCCAGCAGCAGCAGCACGGGACATTCGCGGTGGCGTTGGCTCGTCGTCCTCCGGGGCCGCCGGCGCCAGCAGCCTGTCACAGATCCTCAGCGCCAAGCTCCGCAAGTGCTGCAAGACACCGTCCCCGTCCCTCACCTGCCTCCGCCTCGACACCGAGAAGTCCCACATTGGCGTCTGGCAGAAGCGCGCGGGTGCCCGTGCCGACTCCAGCTGGGTCATGACCGTCGAGCTCAACAAGGAGCCGGCCGCAGCGGCACCACCAACGCCCAGCGACAGCACGGTGTCGGCGACTCCTTCCTCGTCCACGTCCACGTCCACAACGGGCTCCCCACCGGAGGCAATGGAGGACGAAGAGAGGATCGCGCTGCAGATGATAGAGGAGCTGCTGAGCAGGAGCAGCCCGGCTTCGCCGTCACATGGGCTGCTGCACGGTGAAGAAGGCAGCCTCCTCATCTGA. :. farming barley in . the UK. ;. the process of malting;. barley . in our . diet;. f. ood and drink made from barley and malt.. Farming barley. Barley is grown on about 1.2 million hectares of land in the UK. . 5.3 . Gbp. . ~ 30,000 genes. Self-pollinated (hermaphroditic). Inflorescence type. 2-row vs. 6-row. 1 gene/30,000 genes. . Covered vs. Naked . 1 gene/30,000 genes. Growth Habit. Winter, facultative and spring. ;. . the. . study of . biology. at the . molecular. level.. Molecular biology. ;. . the. . study of . gene . structure and functions at the . molecular level. . to understand the molecular basis of hereditary, genetic variation, and the expression patterns of genes. . Barley is a member of the . Gramineae. family.. In Ireland Barley is grown in two forms. Feeding barley is used as an animal feed.. Malting barley is used for malting and brewing alcohol.. Barley is easily distinguished from other cereals by the awns present on the grain. Outline. Barley Genotype Contribution to Beer Flavor . – What do we still want to know?. Romp of Otters 1.0 . – What does Maris Otter contribute to a breeding population?. Romp of Otters 2.0 . – How does the top otter perform in a craft, floor malting system? . Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). In the beginning there was spontaneity: .
Download Document
Here is the link to download the presentation.
"Barley – Molecular Breeding"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents