PPT-Barley Yield Gaps, Varietal Adoption, and Seed Commercial B
Author : alexa-scheidler | Published Date : 2017-07-03
ABSTRACT Barley is among the major food security crops in the highlands and industrial commodity for the emerging brewery industry This paper documents the
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Barley Yield Gaps, Varietal Adoption, an..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Barley Yield Gaps, Varietal Adoption, and Seed Commercial B: Transcript
ABSTRACT Barley is among the major food security crops in the highlands and industrial commodity for the emerging brewery industry This paper documents the current productivity levels varietal adoption and seed commercial . Patrick Hayes. Dept. Crop and Soil Science. Oregon State University. Corvallis, Oregon USA. www.barleyworld.org. What barley was. What barley is. What barley could be . First crop domesticated (?) . Beer . Update. Barley Supply & Demand Table. . U.S.. Barley. 2010/2011(Est.). 2011/2012(Feb). 2011/2012(Mar). Planted A.. 2.87. . Mill. A.. 2.56 Mill. A.. 2.56 Mill. A.. Harvested A.. 2.47 Mill. A.. 2.24 Mill. A.. Global and local considerations. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). Grape, Nut and Tree Fruit Expo. State . of Winegrape. and Concentrate Industries. Jeff Bitter. Allied Grape Growers. November . 16, . 2016. Presentation Outline. Part . 1: The Supply/Demand . F. oundation. http://www.lincfoods.com/malt. /. http://www.meccagrade.com. /. http://. barleyworld.org/malt-house. Barley contributes to beer flavor. The Flavor 7-Pack. Bells, Deschutes, Firestone-Walker New Glarus, . Facultative . growth habit . . Fall planting. Cold tolerance. o. n demand . Spring planting. Cold tolerance . n. ot needed . Objective 1 – Fall-planted winter and facultative variety development and . in the northern region: Land Product Photo Producer link Norway Prebaked pizzabun s Duga AS http://duga.no/produkter/ Norway Half cooked buns Duga AS http://duga.no/produkter/ Norway Precooked pita Taketa PNAS 2008. Hulled phenotype controlled by one gene: NUD. >NUD_CDS. ATGGTACAGTCCAAGAAGAAGTTTCGCGGCGTCAGGCAGCGCCACTGGGGCTCCTGGGTCTCCGAGATCAGGCATCCTCTCCTAAGAGGAGGGTGTGGTTGGGCACCTTTGAGACGGCGGAGGAGGCTGCGCGGGCGTACGATGAGGCTGCCATCCTGATGAGCGGGCGCAACGCCAAGACCAACTTCCCCGTACCGAGGAGTGCCAACGGGGAGATCATCGTCGCCCCAGCAGCAGCAGCACGGGACATTCGCGGTGGCGTTGGCTCGTCGTCCTCCGGGGCCGCCGGCGCCAGCAGCCTGTCACAGATCCTCAGCGCCAAGCTCCGCAAGTGCTGCAAGACACCGTCCCCGTCCCTCACCTGCCTCCGCCTCGACACCGAGAAGTCCCACATTGGCGTCTGGCAGAAGCGCGCGGGTGCCCGTGCCGACTCCAGCTGGGTCATGACCGTCGAGCTCAACAAGGAGCCGGCCGCAGCGGCACCACCAACGCCCAGCGACAGCACGGTGTCGGCGACTCCTTCCTCGTCCACGTCCACGTCCACAACGGGCTCCCCACCGGAGGCAATGGAGGACGAAGAGAGGATCGCGCTGCAGATGATAGAGGAGCTGCTGAGCAGGAGCAGCCCGGCTTCGCCGTCACATGGGCTGCTGCACGGTGAAGAAGGCAGCCTCCTCATCTGA. :. farming barley in . the UK. ;. the process of malting;. barley . in our . diet;. f. ood and drink made from barley and malt.. Farming barley. Barley is grown on about 1.2 million hectares of land in the UK. . 5.3 . Gbp. . ~ 30,000 genes. Self-pollinated (hermaphroditic). Inflorescence type. 2-row vs. 6-row. 1 gene/30,000 genes. . Covered vs. Naked . 1 gene/30,000 genes. Growth Habit. Winter, facultative and spring. Barley is a member of the . Gramineae. family.. In Ireland Barley is grown in two forms. Feeding barley is used as an animal feed.. Malting barley is used for malting and brewing alcohol.. Barley is easily distinguished from other cereals by the awns present on the grain. irrigated . ABI Voyager in Montana.. ABI Voyager. The following agronomic, yield and quality, pathology and botanical information on ABI Voyager is based on the best available data (Global Barley Research, SmartBarley, and University of Idaho). However, it is up to each farmer to interpret the validity of the contained information and assess how it relates to their own barley growing operations.. Outline. Barley Genotype Contribution to Beer Flavor . – What do we still want to know?. Romp of Otters 1.0 . – What does Maris Otter contribute to a breeding population?. Romp of Otters 2.0 . – How does the top otter perform in a craft, floor malting system? . Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). In the beginning there was spontaneity: .
Download Document
Here is the link to download the presentation.
"Barley Yield Gaps, Varietal Adoption, and Seed Commercial B"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents