PPT-Objective: Convert a hulled (covered) barley into a hull-less (Naked!) barley

Author : leah | Published Date : 2022-05-17

Taketa PNAS 2008 Hulled phenotype controlled by one gene NUD gtNUDCDS ATGGTACAGTCCAAGAAGAAGTTTCGCGGCGTCAGGCAGCGCCACTGGGGCTCCTGGGTCTCCGAGATCAGGCATCCTCTCCTAAGAGGAGGGTGTGGTTGGGCACCTTTGAGACGGCGGAGGAGGCTGCGCGGGCGTACGATGAGGCTGCCATCCTGATGAGCGGGCGCAACGCCAAGACCAACTTCCCCGTACCGAGGAGTGCCAACGGGGAGATCATCGTCGCCCCAGCAGCAGCAGCACGGGACATTCGCGGTGGCGTTGGCTCGTCGTCCTCCGGGGCCGCCGGCGCCAGCAGCCTGTCACAGATCCTCAGCGCCAAGCTCCGCAAGTGCTGCAAGACACCGTCCCCGTCCCTCACCTGCCTCCGCCTCGACACCGAGAAGTCCCACATTGGCGTCTGGCAGAAGCGCGCGGGTGCCCGTGCCGACTCCAGCTGGGTCATGACCGTCGAGCTCAACAAGGAGCCGGCCGCAGCGGCACCACCAACGCCCAGCGACAGCACGGTGTCGGCGACTCCTTCCTCGTCCACGTCCACGTCCACAACGGGCTCCCCACCGGAGGCAATGGAGGACGAAGAGAGGATCGCGCTGCAGATGATAGAGGAGCTGCTGAGCAGGAGCAGCCCGGCTTCGCCGTCACATGGGCTGCTGCACGGTGAAGAAGGCAGCCTCCTCATCTGA

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "Objective: Convert a hulled (covered) ba..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

Objective: Convert a hulled (covered) barley into a hull-less (Naked!) barley: Transcript


Taketa PNAS 2008 Hulled phenotype controlled by one gene NUD gtNUDCDS ATGGTACAGTCCAAGAAGAAGTTTCGCGGCGTCAGGCAGCGCCACTGGGGCTCCTGGGTCTCCGAGATCAGGCATCCTCTCCTAAGAGGAGGGTGTGGTTGGGCACCTTTGAGACGGCGGAGGAGGCTGCGCGGGCGTACGATGAGGCTGCCATCCTGATGAGCGGGCGCAACGCCAAGACCAACTTCCCCGTACCGAGGAGTGCCAACGGGGAGATCATCGTCGCCCCAGCAGCAGCAGCACGGGACATTCGCGGTGGCGTTGGCTCGTCGTCCTCCGGGGCCGCCGGCGCCAGCAGCCTGTCACAGATCCTCAGCGCCAAGCTCCGCAAGTGCTGCAAGACACCGTCCCCGTCCCTCACCTGCCTCCGCCTCGACACCGAGAAGTCCCACATTGGCGTCTGGCAGAAGCGCGCGGGTGCCCGTGCCGACTCCAGCTGGGTCATGACCGTCGAGCTCAACAAGGAGCCGGCCGCAGCGGCACCACCAACGCCCAGCGACAGCACGGTGTCGGCGACTCCTTCCTCGTCCACGTCCACGTCCACAACGGGCTCCCCACCGGAGGCAATGGAGGACGAAGAGAGGATCGCGCTGCAGATGATAGAGGAGCTGCTGAGCAGGAGCAGCCCGGCTTCGCCGTCACATGGGCTGCTGCACGGTGAAGAAGGCAGCCTCCTCATCTGA. S Barley is the worlds oldest grain as evidenced by discoveries in ancient cities in the Mideast and North Africa It has been cultivate d for about 8000 years and today is the worlds fourth largest cereal crop Ba rley as a food is most commonly ident AND Hull Present Buckled on Hull Hull Turn Sufficiently Iceberg Passengers Sealed Atlantic (18 knots) into New York City late Hull Lives Iceberg Lives Change steel hull lifeboats Add more lifeboats C he naked truth abouthe naked truth about . Crop. LIFE12 ENV/IT/000356. 01/01/2014-31/12/2015. Barley. . Crop. Photo. 1. . Barley. . crop. 30/03/2015. Barley. . Crop. Photo. 2. . Barley. . crop. 30/03/2015. Barley. . Crop. Photo. Source: CMBTC. Source: CMBTC. Source: CMBTC. Source: CGC. Source: CGC. Region. 2011. 2012. 2013. 2014. 2015. Western. Canada. 7,432.0. 7,488.8. 9,748.3. 6,853.6. 7,199.5. Eastern Canada. 459.5. 523.5. Jane Addams and Ellen Starr moved into Hull House on September 18, 1889. . E. Starr. J. Addams. WHY?. Immigrants coming to America. low wage working families. the needy children of Chicago. Hull House was situated at 800 S. Halstead Street in the run-down Nineteenth Ward of Chicago. . Global and local considerations. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). Chromosome mapping by recombination . Meiosis is the basis of transmission genetics. The recombination that occurs during meiosis (in heterozygotes) generates data that are a useful tool for making linkage maps. Hordeum. . spontaneum. Now . there is . …...... : . Hordeum. . vulgare. * . 2n = 2x = 14. 5.3 . Gbp. . ~ 30,000 genes. Self-pollinated (hermaphroditic). * Technically speaking . spontaneum . Global and local considerations. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). Interest Rates. Chapter 4. 1. Types of Rates. Treasury rate. LIBOR . Fed funds rate. Repo rate . Fundamentals of Futures and Options Markets, 9th Ed, Ch 4, Copyright © John C. Hull 2016. 2. Treasury Rates. 5.3 . Gbp. . ~ 30,000 genes. Self-pollinated (hermaphroditic). Inflorescence type. 2-row vs. 6-row. 1 gene/30,000 genes. . Covered vs. Naked . 1 gene/30,000 genes. Growth Habit. Winter, facultative and spring. a mealy endosperm, the starch granules are relatively looselypacked in the protein matrix, unlike those in a steely endosperm,which has tight protein-starch packing (Bamforth and Barclay1993).All the Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). In the beginning there was spontaneity: .

Download Document

Here is the link to download the presentation.
"Objective: Convert a hulled (covered) barley into a hull-less (Naked!) barley"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents