PPT-Objective: Convert a hulled (covered) barley into a hull-less (Naked!) barley

Author : leah | Published Date : 2022-05-17

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "Objective: Convert a hulled (covered) ba..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

Objective: Convert a hulled (covered) barley into a hull-less (Naked!) barley: Transcript

Taketa PNAS 2008 Hulled phenotype controlled by one gene NUD gtNUDCDS ATGGTACAGTCCAAGAAGAAGTTTCGCGGCGTCAGGCAGCGCCACTGGGGCTCCTGGGTCTCCGAGATCAGGCATCCTCTCCTAAGAGGAGGGTGTGGTTGGGCACCTTTGAGACGGCGGAGGAGGCTGCGCGGGCGTACGATGAGGCTGCCATCCTGATGAGCGGGCGCAACGCCAAGACCAACTTCCCCGTACCGAGGAGTGCCAACGGGGAGATCATCGTCGCCCCAGCAGCAGCAGCACGGGACATTCGCGGTGGCGTTGGCTCGTCGTCCTCCGGGGCCGCCGGCGCCAGCAGCCTGTCACAGATCCTCAGCGCCAAGCTCCGCAAGTGCTGCAAGACACCGTCCCCGTCCCTCACCTGCCTCCGCCTCGACACCGAGAAGTCCCACATTGGCGTCTGGCAGAAGCGCGCGGGTGCCCGTGCCGACTCCAGCTGGGTCATGACCGTCGAGCTCAACAAGGAGCCGGCCGCAGCGGCACCACCAACGCCCAGCGACAGCACGGTGTCGGCGACTCCTTCCTCGTCCACGTCCACGTCCACAACGGGCTCCCCACCGGAGGCAATGGAGGACGAAGAGAGGATCGCGCTGCAGATGATAGAGGAGCTGCTGAGCAGGAGCAGCCCGGCTTCGCCGTCACATGGGCTGCTGCACGGTGAAGAAGGCAGCCTCCTCATCTGA. S Barley is the worlds oldest grain as evidenced by discoveries in ancient cities in the Mideast and North Africa It has been cultivate d for about 8000 years and today is the worlds fourth largest cereal crop Ba rley as a food is most commonly ident Chromosome mapping by recombination . Meiosis is the basis of transmission genetics. The recombination that occurs during meiosis (in heterozygotes) generates data that are a useful tool for making linkage maps. Barley grain comes off the plant in two Patrick Hayes. Dept. Crop and Soil Science. Oregon State University. Corvallis, Oregon USA. www.barleyworld.org. What barley was. What barley is. What barley could be . First crop domesticated (?) . Beer . . Crop. LIFE12 ENV/IT/000356. 01/01/2014-31/12/2015. Barley. . Crop. Photo. 1. . Barley. . crop. 30/03/2015. Barley. . Crop. Photo. 2. . Barley. . crop. 30/03/2015. Barley. . Crop. Photo. Global and local considerations. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). Hordeum. . spontaneum. Now . there is . …...... : . Hordeum. . vulgare. * . 2n = 2x = 14. 5.3 . Gbp. . ~ 30,000 genes. Self-pollinated (hermaphroditic). * Technically speaking . spontaneum . Hordeum. . spontaneum. Now . there is . …...... : . Hordeum. . vulgare. * . 2n = 2x = 14. 5.3 . Gbp. . ~ 30,000 genes. Self-pollinated (hermaphroditic). * Technically speaking . spontaneum . Global and local considerations. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). http://www.lincfoods.com/malt. /. http://www.meccagrade.com. /. http://. barleyworld.org/malt-house. Barley contributes to beer flavor. The Flavor 7-Pack. Bells, Deschutes, Firestone-Walker New Glarus, . 5.3 . Gbp. . ~ 30,000 genes. Self-pollinated (hermaphroditic). Inflorescence type. 2-row vs. 6-row. 1 gene/30,000 genes. . Covered vs. Naked . 1 gene/30,000 genes. Growth Habit. Winter, facultative and spring. a mealy endosperm, the starch granules are relatively looselypacked in the protein matrix, unlike those in a steely endosperm,which has tight protein-starch packing (Bamforth and Barclay1993).All the Barley is a member of the . Gramineae. family.. In Ireland Barley is grown in two forms. Feeding barley is used as an animal feed.. Malting barley is used for malting and brewing alcohol.. Barley is easily distinguished from other cereals by the awns present on the grain. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). In the beginning there was spontaneity: .

Download Document

Here is the link to download the presentation.
"Objective: Convert a hulled (covered) barley into a hull-less (Naked!) barley"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.