PPT-What is barley? 2n = 2x = 14

53 Gbp 30000 genes Selfpollinated hermaphroditic Inflorescence type 2row vs 6row 1 gene30000 genes Covered vs Naked 1 gene30000 genes Growth Habit Winter facultative and spring. S Barley is the worlds oldest grain as evidenced by discoveries in ancient cities in the Mideast and North Africa It has been cultivate d for about 8000 years and today is the worlds fourth largest cereal crop Ba rley as a food is most commonly ident Patrick Hayes. Dept. Crop and Soil Science. Oregon State University. Corvallis, Oregon USA. www.barleyworld.org. What barley was. What barley is. What barley could be . First crop domesticated (?) . Beer . Update. Barley Supply & Demand Table. . U.S.. Barley. 2010/2011(Est.). 2011/2012(Feb). 2011/2012(Mar). Planted A.. 2.87. . Mill. A.. 2.56 Mill. A.. 2.56 Mill. A.. Harvested A.. 2.47 Mill. A.. 2.24 Mill. A.. . Crop. LIFE12 ENV/IT/000356. 01/01/2014-31/12/2015. Barley. . Crop. Photo. 1. . Barley. . crop. 30/03/2015. Barley. . Crop. Photo. 2. . Barley. . crop. 30/03/2015. Barley. . Crop. Photo. Global and local considerations. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). Source: CMBTC. Source: CMBTC. Source: CMBTC. Source: CGC. Source: CGC. Region. 2011. 2012. 2013. 2014. 2015. Western. Canada. 7,432.0. 7,488.8. 9,748.3. 6,853.6. 7,199.5. Eastern Canada. 459.5. 523.5. Global and local considerations. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). http://www.lincfoods.com/malt. /. http://www.meccagrade.com. /. http://. barleyworld.org/malt-house. Barley contributes to beer flavor. The Flavor 7-Pack. Bells, Deschutes, Firestone-Walker New Glarus, . Facultative . growth habit . . Fall planting. Cold tolerance. o. n demand . Spring planting. Cold tolerance . n. ot needed . Objective 1 – Fall-planted winter and facultative variety development and . Taketa PNAS 2008. Hulled phenotype controlled by one gene: NUD. >NUD_CDS. ATGGTACAGTCCAAGAAGAAGTTTCGCGGCGTCAGGCAGCGCCACTGGGGCTCCTGGGTCTCCGAGATCAGGCATCCTCTCCTAAGAGGAGGGTGTGGTTGGGCACCTTTGAGACGGCGGAGGAGGCTGCGCGGGCGTACGATGAGGCTGCCATCCTGATGAGCGGGCGCAACGCCAAGACCAACTTCCCCGTACCGAGGAGTGCCAACGGGGAGATCATCGTCGCCCCAGCAGCAGCAGCACGGGACATTCGCGGTGGCGTTGGCTCGTCGTCCTCCGGGGCCGCCGGCGCCAGCAGCCTGTCACAGATCCTCAGCGCCAAGCTCCGCAAGTGCTGCAAGACACCGTCCCCGTCCCTCACCTGCCTCCGCCTCGACACCGAGAAGTCCCACATTGGCGTCTGGCAGAAGCGCGCGGGTGCCCGTGCCGACTCCAGCTGGGTCATGACCGTCGAGCTCAACAAGGAGCCGGCCGCAGCGGCACCACCAACGCCCAGCGACAGCACGGTGTCGGCGACTCCTTCCTCGTCCACGTCCACGTCCACAACGGGCTCCCCACCGGAGGCAATGGAGGACGAAGAGAGGATCGCGCTGCAGATGATAGAGGAGCTGCTGAGCAGGAGCAGCCCGGCTTCGCCGTCACATGGGCTGCTGCACGGTGAAGAAGGCAGCCTCCTCATCTGA. :. farming barley in . the UK. ;. the process of malting;. barley . in our . diet;. f. ood and drink made from barley and malt.. Farming barley. Barley is grown on about 1.2 million hectares of land in the UK. . Bradbury et al. . fgr. (Bad2) . DNA sequences . identical . for. . fragrant rice accessions . DNA sequences . identical. for non-fragrant accessions . DNA sequences . different. between fragrant and non-fragrant accessions. Barley is a member of the . Gramineae. family.. In Ireland Barley is grown in two forms. Feeding barley is used as an animal feed.. Malting barley is used for malting and brewing alcohol.. Barley is easily distinguished from other cereals by the awns present on the grain. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). In the beginning there was spontaneity: .