PPT-Barley Protein Concentrate
Author : danika-pritchard | Published Date : 2015-10-24
The first plant protein with the nutritional quality and potential volume to effectively replace fishmeal in aquaculture feeds Barley Protein Concentrate MMP
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Barley Protein Concentrate" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Barley Protein Concentrate: Transcript
The first plant protein with the nutritional quality and potential volume to effectively replace fishmeal in aquaculture feeds Barley Protein Concentrate MMP developed biological fractionation process . Hot Water. Step 1:. Add tea concentrate from the teapot on the top. Step 2:. Add hot water to thin down the concentrate from the hot water vessel. Patrick Hayes. Dept. Crop and Soil Science. Oregon State University. Corvallis, Oregon USA. www.barleyworld.org. What barley was. What barley is. What barley could be . First crop domesticated (?) . Beer . . Crop. LIFE12 ENV/IT/000356. 01/01/2014-31/12/2015. Barley. . Crop. Photo. 1. . Barley. . crop. 30/03/2015. Barley. . Crop. Photo. 2. . Barley. . crop. 30/03/2015. Barley. . Crop. Photo. ABSTRACT: . Barley is . among the major . food . security . crops . in the highlands and . industrial commodity . for the emerging brewery industry. This paper documents the current productivity levels, varietal adoption and seed commercial . Global and local considerations. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). Facultative . growth habit . . Fall planting. Cold tolerance. o. n demand . Spring planting. Cold tolerance . n. ot needed . Objective 1 – Fall-planted winter and facultative variety development and . WELLNESS QED. CONTENTS. INDICATIONS. FEATURES. COMPOSITION. RECOMMENDED DOSAGE. APPLICATION. INDICATIONS. INDICATIONS. Protein of choice for critical care & high protein requirements. Helps protects against certain types of harmful bacteria and viruses. In a day and age where people have busier lifestyles, where obesity is becoming a trend, and homes becoming smaller – manufacturers have created an empire surrounding quick and easy meals, snacks, and even drinks. More people prefer instant gratification, which led to wanting things done in an instant – instant messaging, instant coffee, instant noodles, and even instant meals! in the northern region: Land Product Photo Producer link Norway Prebaked pizzabun s Duga AS http://duga.no/produkter/ Norway Half cooked buns Duga AS http://duga.no/produkter/ Norway Precooked pita Taketa PNAS 2008. Hulled phenotype controlled by one gene: NUD. >NUD_CDS. ATGGTACAGTCCAAGAAGAAGTTTCGCGGCGTCAGGCAGCGCCACTGGGGCTCCTGGGTCTCCGAGATCAGGCATCCTCTCCTAAGAGGAGGGTGTGGTTGGGCACCTTTGAGACGGCGGAGGAGGCTGCGCGGGCGTACGATGAGGCTGCCATCCTGATGAGCGGGCGCAACGCCAAGACCAACTTCCCCGTACCGAGGAGTGCCAACGGGGAGATCATCGTCGCCCCAGCAGCAGCAGCACGGGACATTCGCGGTGGCGTTGGCTCGTCGTCCTCCGGGGCCGCCGGCGCCAGCAGCCTGTCACAGATCCTCAGCGCCAAGCTCCGCAAGTGCTGCAAGACACCGTCCCCGTCCCTCACCTGCCTCCGCCTCGACACCGAGAAGTCCCACATTGGCGTCTGGCAGAAGCGCGCGGGTGCCCGTGCCGACTCCAGCTGGGTCATGACCGTCGAGCTCAACAAGGAGCCGGCCGCAGCGGCACCACCAACGCCCAGCGACAGCACGGTGTCGGCGACTCCTTCCTCGTCCACGTCCACGTCCACAACGGGCTCCCCACCGGAGGCAATGGAGGACGAAGAGAGGATCGCGCTGCAGATGATAGAGGAGCTGCTGAGCAGGAGCAGCCCGGCTTCGCCGTCACATGGGCTGCTGCACGGTGAAGAAGGCAGCCTCCTCATCTGA. The Intersections of Low Temperature Tolerance and Growth Habit. Fall-sown crops and resiliency. Optimum use of available precipitation. Escape summer diseases. Double cropping opportunities . . Low temperature tolerance. Bradbury et al. . fgr. (Bad2) . DNA sequences . identical . for. . fragrant rice accessions . DNA sequences . identical. for non-fragrant accessions . DNA sequences . different. between fragrant and non-fragrant accessions. Barley is a member of the . Gramineae. family.. In Ireland Barley is grown in two forms. Feeding barley is used as an animal feed.. Malting barley is used for malting and brewing alcohol.. Barley is easily distinguished from other cereals by the awns present on the grain. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). In the beginning there was spontaneity: .
Download Document
Here is the link to download the presentation.
"Barley Protein Concentrate"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents