PPT-Stem rust resistance in barley: complexity of
Author : catherine | Published Date : 2023-10-30
introgressing rpg4rpg5 into TTKSK susceptible germplasm Department of Crop and Soil Science Javier Hernandez Phd student Patrick Hayes Professor Barley project
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Stem rust resistance in barley: complexi..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Stem rust resistance in barley: complexity of: Transcript
introgressing rpg4rpg5 into TTKSK susceptible germplasm Department of Crop and Soil Science Javier Hernandez Phd student Patrick Hayes Professor Barley project Oregon State University. coukfood Veal cutlet marinated in barley miso ginger and yuzu with burnt chili cucumber pickle Ingredients For the barley miso marinade 3 tbsp barley miso 3 tbsp finely chopped fresh root ginger 3 tbsp finely diced y Mina Talajoor. Department of Plant Sciences & Plant Pathology. Montana . State . University. Triticum turgidum. . (2n=4x, AABB) . Origins of Wheat. Triticum aestivum. (2n=6x, AABBDD). Aegilops. . Patrick Hayes. Dept. Crop and Soil Science. Oregon State University. Corvallis, Oregon USA. www.barleyworld.org. What barley was. What barley is. What barley could be . First crop domesticated (?) . Beer . Source: CMBTC. Source: CMBTC. Source: CMBTC. Source: CGC. Source: CGC. Region. 2011. 2012. 2013. 2014. 2015. Western. Canada. 7,432.0. 7,488.8. 9,748.3. 6,853.6. 7,199.5. Eastern Canada. 459.5. 523.5. Global and local considerations. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). ABSTRACT: . Barley is . among the major . food . security . crops . in the highlands and . industrial commodity . for the emerging brewery industry. This paper documents the current productivity levels, varietal adoption and seed commercial . ….... full speed ahead . David Glasgow Farragut; Battle of Mobile Bay. Dodging the torpedoes of the confederacy . Full speed ahead and damn the torpedoes . 2017 BIC; Facultative/winter 2-row malting barley. ….... full speed ahead . David Glasgow Farragut; Battle of Mobile Bay. Dodging the torpedoes of the confederacy . Full speed ahead and damn the torpedoes . 2017 BIC; Facultative/winter 2-row malting barley. Facultative . growth habit . . Fall planting. Cold tolerance. o. n demand . Spring planting. Cold tolerance . n. ot needed . Objective 1 – Fall-planted winter and facultative variety development and . YAVA Sridhar Reddy 1. PG Scholar, Dept of PG studies in Ayurveda Siddhanta, GAMC 2. PG Scholar, Dept of PG studies in Ayurveda Siddhanta, GAMC Mysore, Karnataka, India. 3. Lecturer, Dept of PG stu in the northern region: Land Product Photo Producer link Norway Prebaked pizzabun s Duga AS http://duga.no/produkter/ Norway Half cooked buns Duga AS http://duga.no/produkter/ Norway Precooked pita Taketa PNAS 2008. Hulled phenotype controlled by one gene: NUD. >NUD_CDS. ATGGTACAGTCCAAGAAGAAGTTTCGCGGCGTCAGGCAGCGCCACTGGGGCTCCTGGGTCTCCGAGATCAGGCATCCTCTCCTAAGAGGAGGGTGTGGTTGGGCACCTTTGAGACGGCGGAGGAGGCTGCGCGGGCGTACGATGAGGCTGCCATCCTGATGAGCGGGCGCAACGCCAAGACCAACTTCCCCGTACCGAGGAGTGCCAACGGGGAGATCATCGTCGCCCCAGCAGCAGCAGCACGGGACATTCGCGGTGGCGTTGGCTCGTCGTCCTCCGGGGCCGCCGGCGCCAGCAGCCTGTCACAGATCCTCAGCGCCAAGCTCCGCAAGTGCTGCAAGACACCGTCCCCGTCCCTCACCTGCCTCCGCCTCGACACCGAGAAGTCCCACATTGGCGTCTGGCAGAAGCGCGCGGGTGCCCGTGCCGACTCCAGCTGGGTCATGACCGTCGAGCTCAACAAGGAGCCGGCCGCAGCGGCACCACCAACGCCCAGCGACAGCACGGTGTCGGCGACTCCTTCCTCGTCCACGTCCACGTCCACAACGGGCTCCCCACCGGAGGCAATGGAGGACGAAGAGAGGATCGCGCTGCAGATGATAGAGGAGCTGCTGAGCAGGAGCAGCCCGGCTTCGCCGTCACATGGGCTGCTGCACGGTGAAGAAGGCAGCCTCCTCATCTGA. Barley is a member of the . Gramineae. family.. In Ireland Barley is grown in two forms. Feeding barley is used as an animal feed.. Malting barley is used for malting and brewing alcohol.. Barley is easily distinguished from other cereals by the awns present on the grain. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). In the beginning there was spontaneity: .
Download Document
         Here is the link to download the presentation.
"Stem rust resistance in barley: complexity of"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
	 
        
Related Documents

 
         
         
         
         
         
         
         
         
         
         
         
         
        