PDF-Conserved non coding sequences are reliable guide to regulatory elements
Author : lindy-dunigan | Published Date : 2017-03-23
0168952500
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Conserved non coding sequences are reli..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Conserved non coding sequences are reliable guide to regulatory elements: Transcript
0168952500. brPage 2br REGULATORY GUIDE 100 Enforceable undertakings Australian Securities and Investments Commission March 2007 Page What this guide is about 1 This guide explains our appr oach to accepting undertakings under s93A and 93AA of the Australian S John . McGuigan. 05/04/2009. Highly Conserved Elements. The most . conserved elements at least 200 . bp. long. Highly Conserved Elements are a much broader . set than UCEs. At least 200 . bp. long. TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA. GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT. CCCTGTTTCCAGGTTTGTTGTCCCAAAATAGTGACCATTTCATATGTATA. Comparative Genomics. Function. Overview. I. Comparing genome sequences. Dr. Po-Han . Lee (. 李柏翰. )/phlee@narlabs.org.tw. . National . Applied Research Laboratories, National Center for High-performance Computing . Division. ----20140409-11-- . PRAGMA 26 . Workshop----. Family Inheritance. Me vs. . my brother. My . dad (my Y). Mom’s . dad. (uncle’s Y). Human ancestry. Disease risk. Genomics: . Regions . . mechanisms . . drugs. Systems. : genes . combinations pathways. Kerstin . Lindblad-. Toh. . et al. . 2011. Presentation by Robert Lewis and Kaylee Wells. What is Evolutionary Constraint?. Restrictions that conserve non-deleterious alleles!. Explains why something didn’t . TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA. GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT. CCCTGTTTCCAGGTTTGTTGTCCCAAAATAGTGACCATTTCATATGTATA. Comparative Genomics. Function. Overview. I. Comparing genome sequences. The linear comparison of more than two sequences. Places residues in columns . per . position specific similarity scores . reflects . relationships . of the . sequences. the scores are based on . Places residues in columns . per . position specific similarity scores . reflects . relationships . of the . sequences. the scores are based on . indels. (gaps) and substitutions.. The alignment of residues implies that they have similar roles in the proteins or DNA sequences being aligned . MedDRA. . MedDRA was developed under the auspices of the International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH). The activities of the MedDRA Maintenance and Support Services Organization (MSSO) are overseen by an ICH MedDRA Management Board, which is composed of the six ICH parties (EU, EFPIA, MHLW, JPMA, FDA, PhRMA), the Medicines and Healthcare products Regulatory Agency (MHRA) of the UK, Health Canada, and the WHO (as Observer). . A Project by: Grace Wang. summary. This project is research on the conservation of amino acids through evolution.. By taking amino acid sequences from a protein called ATM and running them through a program we can see where the conserved regions are.. Kim . Gernert. Emory University, Atlanta, GA. Vedham. . Karpakakunjaram. Montgomery College, Rockville, MD. Target Audience. Students enrolled in Principles of Biology I (BI 107) and II (BI 108). Human salivary amylase: used in one of our lab modules, so students are familiar with this enzyme and its function. Yu He. 04/13/2016. Adapted from the multiple sequence alignment presentations . by . Mingchao. . Xie. and Julie Thompson. Last update: 08/09/2021. Multiple sequence alignments. Multiple Sequence Alignment . Dispersed repeats:. Transposable Elements. Repetitive DNA sequences. Nuclear Genome. Tandem repeats. Class II. DNA . transposons copied and moved via DNA. Class I Retrotransposons . amplifying via an RNA intermediate.
Download Document
Here is the link to download the presentation.
"Conserved non coding sequences are reliable guide to regulatory elements"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents