PPT-The Earliest Humans Outcome: Human Migration & Beginning of Agriculture
Author : motivatorprada | Published Date : 2020-06-16
Human Migration amp Beginning of Agriculture Setting the Stage Who are we Ev idence suggests humans could be much older than originally thought Scientists use
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "The Earliest Humans Outcome: Human Migra..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
The Earliest Humans Outcome: Human Migration & Beginning of Agriculture: Transcript
Human Migration amp Beginning of Agriculture Setting the Stage Who are we Ev idence suggests humans could be much older than originally thought Scientists use artifacts to search for answers. Spirituality. Part 1. Christianity. Resist current modernity . (where postmodernism has led). Fundamentalism . Challenge the current modernity. Re-articulate but maintain orthodoxy. Adaptation / Acquiescence. © Student Handouts, Inc.. First Theories of Human Evolution. Charles Darwin. On the Origin of Species. . (1859). First to link biological diversity to evolution. The Descent of Man, and Selection in Relation to Sex. © Student Handouts, Inc.. First Theories of Human Evolution. Charles Darwin. On the Origin of Species. . (1859). First to link biological diversity to evolution. Thomas Huxley. Evidence as to Man’s Place in Nature. Period 1 Review. Big Picture: Turning Points. Emergence of Humankind. Globalization of Humankind. Revolution of Farming and Herding. Emergence of Civilizations. Chronology. 1.1: Big . Geography and the Peopling of the Earth. Where did they come from?. How did they meet their basic needs for survival?. What kinds of developments did they make?. How did they express themselves?. How do we know the answers to these questions?. Human Prehistory. The first bipedal hominids emerged over 5 million years ago in Africa.. The human species began to emerge in East Africa around 2.5 million years ago.. Between 2.5 million years ago and 100,000 years ago, the human species went through a variety of evolutionary phases in different parts of the world.. Constructive Response Questions. Describe what early humans were like and why they migrated out of Africa?. Trace the development of the Agricultural Revolution as well as its causes and effects.. What are we going to learn?. Climatic change. Getting drier. Unbroken tropical forests becoming a patchwork of woodland and savanna. . The split. Sometime around 7 mybp east African primates began on an evolutionary path distinct from central and west African primates. . The Mesolithic Age. The . Mesolithic Age. (Middle Stone Age) went from 12,000-8,000 BCE.. Major changes included the ability to shape and sharpen stone tools, make needles out of bone, etc. . More animals were domesticated, like cows.. Human skeletal changes due to . bipedalism. Bipedalism. occurred approximately 4 . mya. .. This has led to . morphological. alterations to the . human skeleton. including changes to the arrangement and size of the bones of the foot, . from. . and . to. . Romania after December 1989 . Assist. prof. Andrei Cotruș. Dimitrie Cantemir University of Tîrgu Mureș - Romania. Erasmus Intensive Programme Summer School. Arab Spring and Transition: a New Perspective in Euro Med Partnership. from. . and . to. . Romania after December 1989 . Assist. prof. Andrei Cotruș. Dimitrie Cantemir University of Tîrgu Mureș - Romania. Erasmus Intensive Programme Summer School. Arab Spring and Transition: a New Perspective in Euro Med Partnership. . feminization. . of. . agriculture. in sub-. Saharan. . Africa. Jordan Chamberlin, Cristina Ramos, Mariam Gharib, Lucy Njogu, Alex Murphy, . Rahma. Adams. Background. Rural . migration. in Sub-. Introduction: Human Population Genomics. ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG. Cost. Killer apps. Roadblocks?. How soon will we all be sequenced?. Time. 2013?. 2018?. Cost. Applications.
Download Document
Here is the link to download the presentation.
"The Earliest Humans Outcome: Human Migration & Beginning of Agriculture"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents