of Acetyl CoA carboxylase ACC subunit accC in Ecoli to enhance fatty acid triacyl glycerol accumulation for Biofuel production Fuel it up ID: 296660
Download Presentation The PPT/PDF document "Over expression" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Slide1
Over expression of Acetyl- CoA carboxylase (ACC) sub-unit accC in E.coli to enhance fatty acid (triacyl glycerol) accumulation for Bio-fuel production”
“Fuel it up”Team members:Parul SirohiSanju Timilsina
1Slide2
Goal:To overexpressed accC gene in E.coli to increases Tri acyl glycerol (TAG) production and then our future goal will be to express the accC gene in any possible microorganisms ( Algae and bacteria) which might enhance lipid production in waste biomass.2Slide3
Introduction Biochemical pathwayThe gene of interest in this project is accC ( Acetyl Co-A carboxylase biotin carboxylase).This gene catalyze the formation of malonyl-CoA
substrate for biosynthesis of fatty acid synthesis.ACC is a multi subunit( accA, accB, accC and accD) enzyme in most prokaryotes. It is also found in the chloroplast of most of plant and algae.Fatty acid is the major prerequisite for bio-fuel production, so its over production might enhance bio-fuel production.Overexpression of the enzyme DGAT is most likely to enhance lipid, Tri-acyl glycerol over production but due to high introns numbers in the source ( Arabidopsis thaliana) we chose ACC over DGAT. Source: NMD courchesne et.al./ journal of biotechnology 141(2009)31-41
3Slide4
Brief overviewSource Organism: E. coli 0157:H7Source: Biology department of University of Northern IowaMedia: Luria Broth
Gene: Acetyl CoA carboxylase biotin carboxylase (accC)Assembly #: NC_011353.1 Region: 4242644..4243993 bp:1350Introns: none ( prokaryote)Bio-brick Compatibility: Compatible 4Slide5
PCR Primer Sequence for accC gene Primers: 24F_Biofuel1P 5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’ 24RP_Biofuel2S 5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’
24F_Biofuel1 5’ atgctggataaaattgttattgccaaccgc 3’ 24RP_Biofuel2 5’ cgagttttttctccagatagtggatgttagtgc3’ 5Slide6
Gene sequence with primers:Forward primer:5’gaattcgcggccgcttctagag atgctggataaaattgttattgccaaccgc 3’ 1
atgctggata aaattgttat tgccaaccgc ggcgagattg cattgcgtat tcttcgtgcc 61 tgtaaagaac tgggcatcaa gactgtcgct gtgcactcca
gcgcggatcg
cgatctaaaa
121
cacgtattac
tggcagatga
aacggtctgt
attggccctg
ctccgtcagt
aaaaagttat
181
ctgaacatcc
cggcaatcat cagcgccgct gaaatcaccg gcgcagtagc aatccatccg 241 ggttacggct tcctctccga gaacgccaac tttgccgagc aggttgaacg ctccggcttt 301 atcttcattg gcccgaaagc agaaaccatt cgcctgatgg gcgacaaagt atccgcaatc 361 gcggcgatga aaaaagcggg cgtcccttgc gtaccgggtt ctgacggccc gctgggcgac 421 gatatggata aaaaccgtgc cattgctaaa cgcattggtt atccggtgat tatcaaagcc 481 tccggcggcg gcggtggtcg cggtatgcgc gtagtgcgcg gcgacgctga actggcacaa 541 tccatctcca tgacccgtgc ggaagcgaaa gctgctttca gcaacgatat ggtttacatg 601 gagaaatacc tggaaaatcc tcgccacgtc gagattcagg tactggctga cggtcagggc 661 aactctatct atctggcgga acgtgactgc tccatgcagc gccgccacca gaaagtggtc 721 gaagaagcac cagcaccggg cattaccccg gaactgcgtc gctacatcgg cgaacgttgc 781 gctaaagcgt gtgttgatat cggctatcgc ggtgcaggta ctttcgagtt cctgttcgaa 841 aacggcgagt tctatttcat cgaaatgaac acccgtattc aggtagaaca cccggttaca 901 gaaatgatca ccggcgttga cctgatcaaa gaacagctgc gtatcgctgc cggtcaaccg 961 ctgtcgatca agcaagaaga agttcacgtt cgcggccatg cggtggaatg tcgtatcaac 1021 gccgaagatc cgaacacctt cctgccaagt ccgggcaaaa tcacccgttt ccacgcacct 1081 ggcggttttg gcgtacgttg ggagtctcat atctacgcgg gctacaccgt accgccgtac 1141 tatgactcaa tgatcggtaa gctgatttgc tacggtgaaa accgtgacgt ggcgattgcc 1201 cgcatgaaga atgcgctgca ggagctgatc atcgacggta tcaaaaccaa cgttgatctg 1261 cagatccgca tcatgaatga cgagaacttc cagcatggtg gcactaacatccactatctggagaaaaaactcg gtcttca ggaaaaataa 3’cgtgattgtaggtgatagacctcttttttgagcgacgtcgccggcgatgatcat 5’ Reverse Primer
6Slide7
Vector Plasmid pSB1A3pSB1A3 is a high copy number plasmid carrying Ampicillin resistance pSB1A3 is a bio-brick compatible plasmid that has prefix(E-X) and suffix(S-P) once in the whole sequenceIts is also compatible for the constitutive promoter family member7Slide8
Promoter/RegulatorPart: BBa_J23100Constitutive promoter family member is the consensus promoter sequence and is the strongest member of the familyRFP(au) of the J23100 is 2547 fold more than in wild type, which means it has 2547 fold more ability to increase enzymatic activity of enzyme in the biochemical pathwaySequence: ttgacggctagctcagtcctaggtacagtgctagcAlternative Promoters:J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc( medium promoter)BBa-K206000(PBad): is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.
8Slide9
Steps Grow the source organism (E. coli) in LB mediaDNA extraction from the source (E. coli)Electrophoresis to check desired DNA segment (bp) Primer designing
Multiplication of gene of interest by PCRElectrophorosisDigestion of Plasmid by restriction enzymes Ligation of accC gene in plasmid vector (pSB1A3)Transformation of vector plasmid into host organism E. coliCloning of cells in a LB mediaSelection for recombinant DNA colonies by antibiotic
selective media (LB+ ampicillin)Inoculation
of E.coli in biomass
Testing of protein by SDS-PAGE and fatty acid
(tri acyl glycerol)
by thin layer chromatography
-Materials for TLC: Silica gel,
-Solvent mixture hexane/diethyl ether/acetic acid(17/3/0.2/v/v/v)
-CuSO4 reagent ( 20g CuSO4, 200ml methanol, 8ml H2SO4 and
8ml
H3PO4))
-acetone/ toluene/ water( 91/30/8,v/v/v)
9Slide10
ReferencesMagnuson, K., Jackowski, S., Rock, C.O., and Cronan, J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522Noemie, M. D., Parisien, A., Wang, B., Lan, C., ( 2009). Enhancement of lipid production using biochemical, genetic and transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41Siaut, M., Cuine, S., Cagnon, C., Fessler, B., Nguyen, M., Carrier, P., Bryly, A., Beisson, F., Triantaphylides, C., Beisson, L., and Peltier, G., (2011). Oil Accumulation in the model green algae Chlamydomonas reinhardetii
: characterization, variability between common laboratory strains and relationship with starch reserves. BMC Biotechnol 2011: 117http://partsregistry.org/Main_Pagehttp://www.ncbi.nlm.nih.gov/http://scholar.google.com/ www.wikipedia.org/10