Upload
Featured Recent Articles Topics Login Upload

Search Results for 'Orthologs'

Orthologs published presentations and documents on DocSlides.

A B Supplemental Figure S4 Causal-gene orthologs in 12 major crops and model species. (A) Across sp
A B Supplemental Figure S4 Causal-gene orthologs in 12 major crops and model species. (A) Across sp
by evelyn
orthologs. varies across species. Error bars indi...
David Emms d avid.emms@plants.ox.ac.uk
David Emms d avid.emms@plants.ox.ac.uk
by jaena
Dept. . Plant Sciences, University of Oxford. Laus...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by olivia-moreira
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
Bacterial Comparative Genomics
Bacterial Comparative Genomics
by alexa-scheidler
Christopher Desjardins, Ph.D.. Earl Lab. Broad In...
Protein Structure Investigating DFR specificity in anthocyanin biosynthesis
Protein Structure Investigating DFR specificity in anthocyanin biosynthesis
by luanne-stotts
Fazeeda Hosein. Sarasvati BahadurSingh. Nigel Jal...
Dissecting plant genomes using
Dissecting plant genomes using
by eve
PLAZA 2.5. Michiel Van Bel. 1,2+. , Sebastian Proo...
Nhx1 Aligning Orthologs
Nhx1 Aligning Orthologs
by emily
and Identifying Alleles. Alexis . Valauri. -Orton ...
Data analysis: GO tools, YeastMine, and use case examples
Data analysis: GO tools, YeastMine, and use case examples
by PeacefulPenguin
SGD: . www.yeastgenome.org. sgd-helpdesk@lists.sta...
Orthology -Based Multi-PGDB
Orthology -Based Multi-PGDB
by beatrice
Curation. Tools . Suzanne Paley. Pathway Tools Wo...