PPT-A B Supplemental Figure S4 Causal-gene orthologs in 12 major crops and model species.
Author : evelyn | Published Date : 2024-03-13
orthologs varies across species Error bars indicate standard deviation
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "A B Supplemental Figure S4 Causal-gene o..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
A B Supplemental Figure S4 Causal-gene orthologs in 12 major crops and model species.: Transcript
orthologs varies across species Error bars indicate standard deviation . Abstract. In many real-world applications, it is important to mine causal relationships where an event or event pattern causes certain outcomes with low probability. Discovering this kind of causal relationships can help us prevent or correct negative outcomes caused by their antecedents. In this paper, we propose an innovative data mining framework and apply it to mine potential causal associations in electronic patient data sets where the drug-related events of interest occur infrequently. Specifically, we created a novel interestingness measure, exclusive causal-leverage, based on a computational, fuzzy recognition-primed decision (RPD) model that we previously developed. On the basis of this new measure, a data mining algorithm was developed to mine the causal relationship between drugs and their associated adverse drug reactions (ADRs). . TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA. GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT. CCCTGTTTCCAGGTTTGTTGTCCCAAAATAGTGACCATTTCATATGTATA. Comparative Genomics. Function. Overview. I. Comparing genome sequences. Christopher Desjardins, Ph.D.. Earl Lab. Broad Institute. Outline. Genomics Terminology. Assemblies vs. Variants. Assembly-based analyses. Orthology. Variant-based analyses. How to choose?. Basic Genomics Terminology. Data source: . Wang R, Pan Y, Li C, et al. Analysis of major known driver mutations and prognosis in resected . adenosquamous. lung carcinomas. J . Thorac. . Oncol. . 2014;9:760-8. . Kohno T, . Nakaoku. Austin Nichols (Abt) & Linden McBride (Cornell). July 27, 2017. Stata Conference. Baltimore, MD. Overview. Machine learning methods dominant for classification/prediction problems.. Prediction is useful for causal inference if one is trying to predict propensity scores (probability of treatment conditional on observables);. Causal arguments are inductive arguments in which the conclusion is a claim that one thing causes another.. For example:. Clogged arteries cause heart attacks. A rough surface produces friction. Exercise during heat causes sweating. Figure . S1. . . (A) . Schematic shows the three KREN1, KREN2, and KREN3 ~20S editosomes, and their protein interactions identified by yeast two-hybrid and co-expression studies (dashed lines) (Schnaufer et al. 2003; Schnaufer et al. 2010; Mehta et al. 2015). (B-D) Networks show detailed editosome architecture revealed by cross-linking and mass spectrometry (CXMS) (McDermott et al. 2016). Network edge widths are proportional to the number of interlinks observed between two proteins. All previously described interactions between editosome proteins were found in our cross-linking data. . Supplemental Figure 1 Supplemental Figure 2 Supplemental Figure 3 Supplemental Figure 4 Supplemental Table 1 Supplemental Figure 5 DMSs . and dietary intake and lifestyle factors at . exam 5 . for . all participants (n=1880). . -log10 (P value). 60. 50. 40. 30. 20. 10. 132 Nutrients/Bioactive . 129 Food group1 (FFD). 29 Food group2 (FG5Serv). fpkm. ). PD-L1 (. fpkm. ). CD8 (. fpkm. ). Iba1 (. fpkm. ). p. < 0.001. p. < 0.001. p. < 0.001. p. < 0.001. GM-CSF. GM-CSF. GM-CSF. GM-CSF. Supplemental Figure 1. Gene expression analysis in breast cancer cases from TCGA database. Gene expression levels of CD8, Iba1, PD-L1, and PD-L2 in breast cancer were compared between the cases with and without GM-CSF expression. The Mann-Whitney . GSE47460_GPL14550 . GSE47460_GPL6480 . Supplemental Figure 2. Megakaryocyte score. Platelet score. FVC. DLCO. A. B. Megakaryocyte score. Platelet score. FVC. DLCO. r = -0.09331, p = 0.5237. r = 0.07781, p = 0.6721. Curation. Tools . Suzanne Paley. Pathway Tools Workshop 2010. Motivations. Closely related organisms contain many . orthologs. , most likely with same functions. Leverage . curation. efforts across multiple . A.. B.. Supplemental Figure 3. Control. α-synuclein. Vehicle. Nicotine. A.. B.. C.. D.. No RNAi. SV2L1 KD. SV2L2 KD. Scale bar: 10nm. 9.5nm. 14.7nm. Average diameter:. A. B. Supplemental figure 2. ELISA using FT and GnH-FT as antigens. A. B. * P <0.05, ** P<0.01, *** P<0.001, and **** P<0.00001. **. *. *.
Download Document
Here is the link to download the presentation.
"A B Supplemental Figure S4 Causal-gene orthologs in 12 major crops and model species."The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents
