PPT-A B Supplemental Figure S4 Causal-gene orthologs in 12 major crops and model species.

Author : evelyn | Published Date : 2024-03-13

orthologs varies across species Error bars indicate standard deviation

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "A B Supplemental Figure S4 Causal-gene o..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

A B Supplemental Figure S4 Causal-gene orthologs in 12 major crops and model species.: Transcript


orthologs varies across species Error bars indicate standard deviation . Algorithmic Computational Genomics. Tandy Warnow. Departments of Bioengineering and Computer Science. http://. tandy.cs.illinois.edu. Course Details. Office hours: Mondays 10-11:45 in 3235 Siebel. Course webpage: . TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA. GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT. CCCTGTTTCCAGGTTTGTTGTCCCAAAATAGTGACCATTTCATATGTATA. Comparative Genomics. Function. Overview. I. Comparing genome sequences. Chapter 9. Figure 9.1 Generalized stages common to all species invasions. A species must successfully...species. that proceed from one stage to the next is less than the previous one (depicted by arrow width).. Christopher Desjardins, Ph.D.. Earl Lab. Broad Institute. Outline. Genomics Terminology. Assemblies vs. Variants. Assembly-based analyses. Orthology. Variant-based analyses. How to choose?. Basic Genomics Terminology. Figure . S1. . . (A) . Schematic shows the three KREN1, KREN2, and KREN3 ~20S editosomes, and their protein interactions identified by yeast two-hybrid and co-expression studies (dashed lines) (Schnaufer et al. 2003; Schnaufer et al. 2010; Mehta et al. 2015). (B-D) Networks show detailed editosome architecture revealed by cross-linking and mass spectrometry (CXMS) (McDermott et al. 2016). Network edge widths are proportional to the number of interlinks observed between two proteins. All previously described interactions between editosome proteins were found in our cross-linking data. . PLAZA 2.5. Michiel Van Bel. 1,2+. , Sebastian Proost. 1,2+. , Elisabeth Wischnitzki. 1,2. , Sara Mohavedi. 1,2. , Christopher Scheerlinck. 3. , Yves Van de Peer. 1,2. and Klaas Vandepoele. 1,2. . (. DMSs . and dietary intake and lifestyle factors at . exam 5 . for . all participants (n=1880). . -log10 (P value). 60. 50. 40. 30. 20. 10. 132 Nutrients/Bioactive . 129 Food group1 (FFD). 29 Food group2 (FG5Serv). fpkm. ). PD-L1 (. fpkm. ). CD8 (. fpkm. ). Iba1 (. fpkm. ). p. < 0.001. p. < 0.001. p. < 0.001. p. < 0.001. GM-CSF. GM-CSF. GM-CSF. GM-CSF. Supplemental Figure 1. Gene expression analysis in breast cancer cases from TCGA database. Gene expression levels of CD8, Iba1, PD-L1, and PD-L2 in breast cancer were compared between the cases with and without GM-CSF expression. The Mann-Whitney . Dept. . Plant Sciences, University of Oxford. Lausanne. Nov 1. st. 2019. Widespread parallel evolution of plant . Orthology. Review. https://github.com/davidemms. Any group of organisms share a common ancestor. Variable. RR. 95% CI. Missing SBP and base excess imputed. 543. ENDO vs OPEN. 0.58. 0.46-0.73. RT vs OPEN. 3.00. 1.84-4.90.  .  .  .  .  . Transferred 9 OPEN patients with initial endovascular procedures to the ENDO group (missing data imputed). suboptimally. positioned. There was a normal . cardiothymic. silhouette. The lungs were clear. Air in scattered loops of . nondilated. small and large bowel, within all four quadrants of the abdomen.. Scale bar: 10nm. 9.5nm. 14.7nm. Average diameter:. A. B. Supplemental figure 2. ELISA using FT and GnH-FT as antigens. A. B. * P <0.05, ** P<0.01, *** P<0.001, and **** P<0.00001. **. *. *. B. Supplemental Figure 2. Tissue. Adrenal gland . Appendix. Appendix . Bone marrow . Breast . Breast cancer. Bronchus Respiratory . Cartilage. Cerebellum . Cerebellum . Cerebellum . Cerebral cortex. Cerebral cortex. GCC 3017: Guest Lecture. Nevin Young. Fall Semester 2018. GCC 3017 - 2018. 1. GM-Crop success stories, controversies – . and the shift to CRISPR gene editing. The virus-resistant papaya success story.

Download Document

Here is the link to download the presentation.
"A B Supplemental Figure S4 Causal-gene orthologs in 12 major crops and model species."The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents