PPT-1 Femelle Mâle Drosophila melanogaster
Author : triclin | Published Date : 2020-08-05
httpsvtoiseletfreefrIMGswfmeioseswf 2 Le cycle de développement de la drosophile Œuf 1 j L1 1 j L2 2 j L3 5 j Pupe 2 j
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "1 Femelle Mâle Drosophila melanogaster" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
1 Femelle Mâle Drosophila melanogaster: Transcript
httpsvtoiseletfreefrIMGswfmeioseswf 2 Le cycle de développement de la drosophile Œuf 1 j L1 1 j L2 2 j L3 5 j Pupe 2 j. 898 S. McNabb, S. Greig and T. Davis TABLE 1 Chromosomes used in this study grouped by progenitor Aberration Previous name Breakpoints Molecular" A. On 6 Adh'; cn b7u Df(2L)A47 Df(2L)A48 Of( 2L)A 63 Experiment Organism t(minutes) #samples #periods #genes CDC15[30] S.cerevisiae 10/20 24 3.2 6178 CDC28[8] S.cerevisiae 10 17 1.8 6220 Drosophila[25] D.melanogaster 240 6 0.83 14,010 Table1.CDC15,CDC2 624 . - Developmental Genetics. Lecture . #4 – . Gastrulation. . Movements. . GASTRULATION is a complex series of cell movements that:. --rearranges cells, giving them new neighbors. --results in the formation of 3 GERM LAYERS that will form the subsequent embryo: ectoderm, endoderm and mesoderm. BTEC Applied Science. Unit 18: Genetics. Assignment 3: Inheritance. Starter Quiz. For Each question, write down the answer in your notes…. Question 1:. Which is the Male fly?. A. B. Question 2. What mutation is this fly displaying?. Student Annotation Submissions. contributions from. Paul Lee, David Xiong, Thomas Quisenberry . Annotating multiple genes at the same locus based on BLASTX alignments. Over-reliance on BLAST alignments. ABSTRACT Function in Drosophila melanogaster Duke University Date:_______________________ Approved: ___________________________ Daniel P. Kiehart, Supervisor ___________________________ Daniel J. Lew Pest of thin-skinned fruit . Found throughout the eastern states to North Dakota. Can attack sound fruit before they fully ripen. What makes this fruit fly different is the females ovipositor (egg layer), it has teeth to penetrate the skin of fruit. Orb2 dependent . long-term memory maintenance in Drosophila . Natalie . Galles. S. N. Bose Research Exchange. Summer 2016. Lab 11 . nccs. – . pune. Internship at NCCS, Pune. Spent my 8 weeks working in Lab 11 under direction of Dr. . Last Updated: 12/26/2021. Wilson Leung and Chris Shaffer. Agenda. Overview of the GEP annotation project. GEP annotation strategy. Types of evidence. Analysis tools. Web databases. Annotation of a single isoform (walkthrough). Wilson Leung 01/2014. Agenda. Overview of the modENCODE species. Problems with the version 1 genome assembly. Improvements in the version 2 genome assembly. Pipeline used to create the sequence improvement projects. An introduction to web tools, . databases, and NCBI BLAST. Wilson Leung 12/2021. Agenda. GEP annotation project overview. Web databases for . Drosophila. annotation. UCSC Genome Browser. NCBI / BLAST. Drosophila . melanogaster. Drosophila Melanogaster, a popular genetic model organism. ~ 50% of fly genes have vertebrate homologs. Small and easy to grow in lab. Short generation time . Produce high amounts of offspring. . Phylogenetic relationships and estimated divergence times of major lineages in the genus Drosophila. Taxa in bold are pr 2606 frame (ORF) was cloned into the I site of pAc5.1/c-MYC-HISAusing the following PCR primers: AcCYLD-F: 5-CCCGAATTCC A -AAATGATCTTAAACAACAA AAG TAAAAC-3CCCCTCGAGATGGTACATCATTA TATCTGTGC-3MYC-HIS A
Download Document
Here is the link to download the presentation.
"1 Femelle Mâle Drosophila melanogaster"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents
