PPT-Linkage Disequilibrium Outline
Author : vivian | Published Date : 2023-10-29
Linkage disequilibrium LD Definition of linkage disequilibrium Importance of disequilibrium Measures of disequilibrium SNP selection Public resources Tag SNP selection
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Linkage Disequilibrium Outline" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Linkage Disequilibrium Outline: Transcript
Linkage disequilibrium LD Definition of linkage disequilibrium Importance of disequilibrium Measures of disequilibrium SNP selection Public resources Tag SNP selection programs Imputation Definitions. As every instructor of population genetics knows the term is a barrier not an aid to understanding LD means simply a nonrandom association of alleles at two or more loci and detecting LD does not ensure either linkage or a lack of equilibrium The te HapMap. Peter Castaldi. January 29, 2013. Objectives. Introduce the concept of linkage disequilibrium (LD). Describe how the . HapMap. project provides publically available information on genetic variation and LD structure. Copy Number Variations. and SNP Array. Xiaole Shirley Liu. and . Jun Liu. 2. Outline. Definition and motivation. SNP distribution and characteristics. Allele frequency, LD, population stratification. Key Reference. Li, Q., and R. L. Wu, 2009 A . multilocus. model for constructing a linkage disequilibrium map in human populations. . Statistical Applications in Genetics and Molecular Biology . 8 (1): Article 18.. A) Alleles at different loci are independent. B) Alleles at different loci are physically close to each other and on the same chromosome. C) Alternate alleles at the same locus are not independent. D) Alleles at different loci are not independent. Key Reference. Li, Q., and R. L. Wu, 2009 A . multilocus. model for constructing a linkage disequilibrium map in human populations. . Statistical Applications in Genetics and Molecular Biology . 8 (1): Article 18.. NASA Astrobiology Institute (NAI). Co-Chairs: . Eugenio . Simoncini. (INAF-. Arcetri. ) . Laurie Barge (JPL)*. *standing in: . Kirt. Robinson (ASU). Thermodynamics, . Disequilibrium . and Evolution (TDE). Inheritance of genes that are on different chromosomes vs. close together on the same chromosome. When genes are closely linked on the same chromosome, how does this affect their segregation pattern?. Introduction: Human Population Genomics. ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG. Cost. Killer apps. Roadblocks?. How soon will we all be sequenced?. Time. 2013?. 2018?. Cost. Applications. Measures of LD. Jess Paulus, ScD. January 29, 2013. . Today’s topics. Multiple comparisons. Measures of Linkage disequilibrium. D’ and r. 2. r. 2. and power. Multiple testing & significance thresholds. Jan. 6 . - . 10, 2020. Shanghai. Two faces of one process: phylogenetics vs. population genetics. Phylogenetics – model of speciation. Tine et al., 2014. Population genetics – model of coalescence. LinkageLinkage can be physical or statistical wefocus on physical - easier to understandBecause of recombination Mendel developslaw of independent assortmentBut loci do not always assort independently Genes in populations. Gene and genotype frequencies. Hardy-Weinberg . equilibrium. Linkage . disequilibrium. Descriptive statistics for quantitative traits. Genetic variance. Heritability. Relationships among relatives. Ames researcher Tori Hoehler collects a core of marine sediment at Cape Lookout Bight, NC, one of several ‘methanogenic’ ecosystems considered in this study.. Science question.. The combination of hydrogen (.
Download Document
Here is the link to download the presentation.
"Linkage Disequilibrium Outline"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents