PPT-Changes in Highly Conserved Elements

John McGuigan 05042009 Highly Conserved Elements The most conserved elements at least 200 bp long Highly Conserved Elements are a much broader set than UCEs At least 200 bp long. brPage 1br Highly Commended Highly Commended brPage 2br WINNER A GRADE Highly Commended brPage 3br WINNER B GRADE Pedersen Angie S Hinrichs Minmei Hou Kate Rosenbloom Hiram Clawson John Spieth LaDeana W Hillier Stephen Richards George M Weinstock Richard K Wilson Richard A Gibbs W James Kent Webb Miller and David Haussler 12 Center for Biomolecular Science and Class Activities: current (1). Class Activities: Current (2). Current through a Wire. A student argues that the current through a wire flows throughout its volume, you:. Agree, resistance is inversely proportional to cross sectional area, not circumference. Development . of the . inventory was . supported by . PHY-. 0757931 and DUE-1044294 from . the . NSF and 1-RC1-. RR028302-01 from the NIH. The free-response study . was . funded by . a Scholarly Activity Improvement Fund . Conserved Quantities. “. Noether's. theorem”. was proven by German mathematician, Emmy . Noether. in 1915 and published in 1918. . . Noether's. theorem has become a fundamental tool of quantum field theory – and has been called "one of the most important mathematical theorems ever proved in guiding the development of modern physics".. Deoxyadenosine. . Methylase. loci.. By: Liam . lewis. Background. H. ighly . I. terated . P. alindrome-1 (HIP-21) . 5’-GCGATCGC-3’. Short, eight nucleotide, palindromic sequence. Extremely abundant among Cyanobacteria. 0168-9525/00/$ TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA. GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT. CCCTGTTTCCAGGTTTGTTGTCCCAAAATAGTGACCATTTCATATGTATA. Comparative Genomics. Function. Overview. I. Comparing genome sequences. (d)define . linear momentum as the product of mass and velocity. (e) define force as rate of change of momentum. (f) recall and solve problems using the relationship F = ma, appreciating. that acceleration and force are always in the same direction. Electrons, 3He, 4He, etc.. And of Non-Conserved Particles. Phonons,. . Magnons. , . Rotons. …. We Found for Non-Conserved Bosons. E.g., Phonons that we can describe the system in terms of canonical coordinates. Momentum & Collisions. Momentum and Collisions. Momentum is a quantity of motion that depends on both the mass and velocity of the object in question:. Remember. : Momentum is a _______________ quantity, with the same sign as its velocity. As with any vector you can assign any direction as positive and the opposite as negative, but as convention we will refer to . How did . the universe come to be the way that it . is?. Democritus (~2500 years ago). Recall the four fundamental forces:. GRAVITY: . All particles are influenced.. Relative strength: . WEAK: . All particles are influenced.. . efficiencies. (. kcat. /km) . for. . wild-type. NDM-1 and NDM-1 . mutants. . . Panel. A, B, A . represents. the . seven. . β. -lactams. . tested. , . divided. in . different. . classes. Elisa Fadda. Computational Glycoscience Lab, . School of Chemistry, NUI Galway. elisa.fadda@nuigalway.ie. Design of Drugs and Chemicals that Influence Biology, IPAM, UCLA, Apr 4. th. - 8. th. 2011. Woods .