PPT-How To Blast David A. Kloske

Author : liane-varnes | Published Date : 2018-03-20

Thermo Fisher Open Biosystems Dr Krishnan K Chittur University of Alabama in Huntsville Dr Joseph Ng University of Alabama in Huntsville What is BLAST BLAST stands

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "How To Blast David A. Kloske" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

How To Blast David A. Kloske: Transcript


Thermo Fisher Open Biosystems Dr Krishnan K Chittur University of Alabama in Huntsville Dr Joseph Ng University of Alabama in Huntsville What is BLAST BLAST stands for B asic L. Basic Local Alignment Search Tool. (Altschul et al. 1990. ). What is blast. ?. BLAST .  DNA/protein databases. GOOGLE  internet. . D. Fristrom, Boston U. .. Uses for Blast. . Identifying unknown sequence. Yanbin Yin. Fall 2014. 1. http://. www.ncbi.nlm.nih.gov. /books/NBK52640/. 2. Why you do need to run BLAST in command line terminal?. NCBI’s server does not have a database that you want to search. 1914 and 1915, Wyndham Lewis, ed.. Percival Wyndham Lewis. 1882-1957. the men of 1914. unpopular. politics – questionable at best. artist, writer, thinker. The Enemy – and its pitfalls. Vorticism. et BLAST . avanc. é. J.. S. .. Bernardes. /H. . Richard. Mat. ériel. :. Bioinformatics and Functional Genomics. Jonathan Pevsner, . Wiley-Blackwell. ed.. Outline. Introduction. . Definition of . Yanbin Yin. Fall 2014. 1. http://. www.ncbi.nlm.nih.gov. /books/NBK52640/. 2. Why you do need to run BLAST in command line terminal?. NCBI’s server does not have a database that you want to search. , Green, Henricks, Jones, Kennedy, . Mawhinney. , . Peluso. , Reilly, Schwartz, Shapiro, . Yanushevsky. Blast Localization and Sensing Technology. Image Courtesy of: . Stanislav. . Klabik. MOTIVATION. Xuhua Xia. xxia@uottawa.ca. http://dambe.bio.uottawa.ca. Why string matching?. Early applications: . Sequence similarity between an oncogene (genes in viruses that cause a cancer-like transformation of the infected cells), v-sis, and the platelet-derived growth factor (PDGF). . Jundi. Wang. School of Computing. CSC691. 09/08/2013. 2. Overview. 1.Introduction of BLAST . Background of BLAST. Programs in BLAST. Function of BLAST. 2.Application of BLAST. What is Oxy Blast?. Oxy Blast is a high quality hydrogen peroxide.. Oxy Blast is a stabilized hydrogen peroxide based product.. Oxy Blast has proprietary homeopathic ingredients to help better the health of the user.. BLAST. Local pairwise alignment heuristic. Faster than standard pairwise alignment programs such as SSEARCH, but less sensitive.. Online server: . http://www.ncbi.nlm.nih.gov/blast. BLAST. Given a query . !Nucleotide sequence of DNA isolated from Chilean Blob. TAATACTAACTATATCCCTACTCTCCATTCTCATCGGGGGTTGAGGAGGACTAAACCAGACTCAACTCCG AAAAATTATAGCTTACTCATCAATCGCCCACATAGGATGAATAACCACAATCCTACCCTACAATACAACC AT Post-Doctoral Fellow. Ochman. Lab. Global . vs. Local Alignments. Global . . The global approach is useful when you are comparing a small group of sequences, but becomes become computationally expensive as the number of sequence in the comparison increases. . Team2. 邱冠儒 黃. 尹. 柔 田. 耕. 豪 蕭. 逸. 嫻 謝朝茂 . 莊閔. 傑. 2014/05/12. 1. BLAST. Basic local alignment search tool. Enable to compare query sequence of amino-acid or protein or DNA to database . Arya L, Rathinam SR, Lalitha P, Kim UR, Ghatani S, Tandon V. Trematode Fluke Procerovum varium as Cause of Ocular Inflammation in Children, South India. Emerg Infect Dis. 2016;22(2):192-200. https://doi.org/10.3201/eid2202.150051.

Download Document

Here is the link to download the presentation.
"How To Blast David A. Kloske"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents