/
Discussion section #2 Discussion section #2

Discussion section #2 - PowerPoint Presentation

lois-ondreau
lois-ondreau . @lois-ondreau
Follow
373 views
Uploaded On 2017-05-12

Discussion section #2 - PPT Presentation

HW1 questions HW2 highestweighed path on a DAG S hortestpath finding algorithms Memoization HW2 highestweighted path on a DAG HW2 highestweight path on a DAG Create input file with one line for each vertex and edge ID: 547503

current seq return fib seq current fib return max path augcuauauaaacgcgauacuauacgcgauaaucgcgcgaga solutions folds folding rna length distance dag memoization highest num weight

Share:

Link:

Embed:

Download Presentation from below link

Download Presentation The PPT/PDF document "Discussion section #2" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.


Presentation Transcript