/
Analysis of Next Generation Sequence Data Analysis of Next Generation Sequence Data

Analysis of Next Generation Sequence Data - PowerPoint Presentation

luanne-stotts
luanne-stotts . @luanne-stotts
Follow
435 views
Uploaded On 2016-09-09

Analysis of Next Generation Sequence Data - PPT Presentation

BIOST 2055 04062015 Last Lecture Genomewide association study has identified thousands of diseaseassociated loci Large consortium performs metaanalysis to further increase the sample size power to detect additional loci ID: 463404

genome reads rare sequence reads genome sequence rare reference variants sequencing data power test prior single read actggtcgatgctagctgatagctagctagctgatgagcccgatcgctgctagctcgacg gctagctgatagctagctagctgatgagcccga

Share:

Link:

Embed:

Download Presentation from below link

Download Presentation The PPT/PDF document "Analysis of Next Generation Sequence Dat..." is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.


Presentation Transcript