PDF-SUPPLEMENTAL DATA
Author : lydia | Published Date : 2021-01-05
Table S1 Primers used in this study Primers name Gene name Primer sequence 5x0027 3x0027 References Autotransporter ehaA α F z0402 ehaA ATATCGGCTAAAGTGGAACAGGTCC 1 ehaA α R
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "SUPPLEMENTAL DATA" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
SUPPLEMENTAL DATA: Transcript
Table S1 Primers used in this study Primers name Gene name Primer sequence 5x0027 3x0027 References Autotransporter ehaA α F z0402 ehaA ATATCGGCTAAAGTGGAACAGGTCC 1 ehaA α R. Linda Beebe. June 2, 2011. SSP June 2, 2011. SSP June 2, 2011. Collision of 2 Worlds. SSP June 2, 2011. Explosion of─. . Research. . Data. . Accrued Knowledge. Increased Requirements. March 28, 2012. Nina Brown, MPH, CHES, Public Health Analyst, OQD. Michelle Bright, Public Health Analyst, OAM. U.S. Department of Health and Human Services. Health Resources and Services Administration. Agricultural Water Definitions. SUPPLEMENTAL MATERIAL. Helpful Definitions. Agricultural water. . must be safe and of adequate sanitary quality for its intended use.. Agricultural water . means water used in covered activities on covered produce where water . AS9104/2A. &. Special Audit Discussion. Tim Lee. The Boeing Company. Chair, IAQG OPMT. 23 July 2015. Purpose. To provide awareness and understanding of the AS9104/2A criteria for AAQG Member supplemental Certification Body (CB) oversight.. Payments for Services Provided in Managed . Care. 1. 2. INTRODUCTION TO Medicaid managed care – THE 3 players . FOR SUPPLEMENTAL PAYMENT PURPOSES. The State - enters into a contract with the managed care entity to arrange for the delivery of Medicaid managed care services. Figure . S1. . . (A) . Schematic shows the three KREN1, KREN2, and KREN3 ~20S editosomes, and their protein interactions identified by yeast two-hybrid and co-expression studies (dashed lines) (Schnaufer et al. 2003; Schnaufer et al. 2010; Mehta et al. 2015). (B-D) Networks show detailed editosome architecture revealed by cross-linking and mass spectrometry (CXMS) (McDermott et al. 2016). Network edge widths are proportional to the number of interlinks observed between two proteins. All previously described interactions between editosome proteins were found in our cross-linking data. . Presented by: . mary. Buckler, . lauren. . mcguirk. & . lisa. sanders. Objectives:. Participants will be able to identify HEDIS Quality Measures. Participants will be able to identify care gap reports from each MCO. What’s Allowed and What’s Not?. TEA’s Student Assessment Division. Fall 2021. Supplemental Aids . This designated support allows a student to use paper-based resources that assist in recalling information.. DMSs . and dietary intake and lifestyle factors at . exam 5 . for . all participants (n=1880). . -log10 (P value). 60. 50. 40. 30. 20. 10. 132 Nutrients/Bioactive . 129 Food group1 (FFD). 29 Food group2 (FG5Serv). fpkm. ). PD-L1 (. fpkm. ). CD8 (. fpkm. ). Iba1 (. fpkm. ). p. < 0.001. p. < 0.001. p. < 0.001. p. < 0.001. GM-CSF. GM-CSF. GM-CSF. GM-CSF. Supplemental Figure 1. Gene expression analysis in breast cancer cases from TCGA database. Gene expression levels of CD8, Iba1, PD-L1, and PD-L2 in breast cancer were compared between the cases with and without GM-CSF expression. The Mann-Whitney . suboptimally. positioned. There was a normal . cardiothymic. silhouette. The lungs were clear. Air in scattered loops of . nondilated. small and large bowel, within all four quadrants of the abdomen.. Scale bar: 10nm. 9.5nm. 14.7nm. Average diameter:. A. B. Supplemental figure 2. ELISA using FT and GnH-FT as antigens. A. B. * P <0.05, ** P<0.01, *** P<0.001, and **** P<0.00001. **. *. *. B. Supplemental Figure 2. Tissue. Adrenal gland . Appendix. Appendix . Bone marrow . Breast . Breast cancer. Bronchus Respiratory . Cartilage. Cerebellum . Cerebellum . Cerebellum . Cerebral cortex. Cerebral cortex. children . aged 2–5 years . in Medicaid receiving . clinical care for . attention-deficit/hyperactivity disorder (ADHD): United States, 2011. 0.45-1.40%. 1.41-1.70%. 1.71-2.05%. 2.06-3.38%. SUPPLEMENTAL FIGURE 5. .
Download Document
Here is the link to download the presentation.
"SUPPLEMENTAL DATA"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents