Download PPT

PDF-SUPPLEMENTAL DATA

Author : lydia | Published Date : 2021-01-05

Table S1 Primers used in this study Primers name Gene name Primer sequence 5x0027 3x0027 References Autotransporter ehaA α F z0402 ehaA ATATCGGCTAAAGTGGAACAGGTCC 1 ehaA α R

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "SUPPLEMENTAL DATA" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

SUPPLEMENTAL DATA: Transcript


Download Rules Of Document


"SUPPLEMENTAL DATA"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents