PDF-SUPPLEMENTAL DATA

Table S1 Primers used in this study Primers name Gene name Primer sequence 5x0027 3x0027 References Autotransporter ehaA α F z0402 ehaA ATATCGGCTAAAGTGGAACAGGTCC 1 ehaA α R. A. Academic/Research Program. Extent of Lung Resection. No. of Subject. Event. Censored. Median Survival (95% CI). 60 mo Survival. Lobectomy. 1778. 616 (35%). 1162 (65%). NA (99.6, NA). 73.6% (71.4%, 75.6%). TAM (1µM). 72 hours. IL-1β levels. 48 hours. LPS (1µM). 0. A. NLRP3i (400μM. ). B. Supplemental Figure 4. Effect of the NLRP3 inflammasome inhibitor on IL‑1β production in bone marrow derived macrophages (BMDM) from genetically modified mice with constitutively active NLRP3.. Data source: . Wang R, Pan Y, Li C, et al. Analysis of major known driver mutations and prognosis in resected . adenosquamous. lung carcinomas. J . Thorac. . Oncol. . 2014;9:760-8. . Kohno T, . Nakaoku. Agricultural Water Definitions. SUPPLEMENTAL MATERIAL. Helpful Definitions. Agricultural water. . must be safe and of adequate sanitary quality for its intended use.. Agricultural water . means water used in covered activities on covered produce where water . Payments for Services Provided in Managed . Care. 1. 2. INTRODUCTION TO Medicaid managed care – THE 3 players . FOR SUPPLEMENTAL PAYMENT PURPOSES. The State - enters into a contract with the managed care entity to arrange for the delivery of Medicaid managed care services. Presented by: . mary. Buckler, . lauren. . mcguirk. & . lisa. sanders. Objectives:. Participants will be able to identify HEDIS Quality Measures. Participants will be able to identify care gap reports from each MCO. Supplemental Figure 1 Supplemental Figure 2 Supplemental Figure 3 Supplemental Figure 4 Supplemental Table 1 Supplemental Figure 5 DMSs . and dietary intake and lifestyle factors at . exam 5 . for . all participants (n=1880). . -log10 (P value). 60. 50. 40. 30. 20. 10. 132 Nutrients/Bioactive . 129 Food group1 (FFD). 29 Food group2 (FG5Serv). GSE47460_GPL14550 . GSE47460_GPL6480 . Supplemental Figure 2. Megakaryocyte score. Platelet score. FVC. DLCO. A. B. Megakaryocyte score. Platelet score. FVC. DLCO. r = -0.09331, p = 0.5237. r = 0.07781, p = 0.6721. 3. Table 1. . Significance level of comparison of absolute sweat rates for all regions measured at exercise intensity 1, uncorrected for multiple comparisons. . Supplemental Digital Content . 3. Table . suboptimally. positioned. There was a normal . cardiothymic. silhouette. The lungs were clear. Air in scattered loops of . nondilated. small and large bowel, within all four quadrants of the abdomen.. A.. B.. Supplemental Figure 3. Control. α-synuclein. Vehicle. Nicotine. A.. B.. C.. D.. No RNAi. SV2L1 KD. SV2L2 KD. B. Supplemental Figure 2. Tissue. Adrenal gland . Appendix. Appendix . Bone marrow . Breast . Breast cancer. Bronchus Respiratory . Cartilage. Cerebellum . Cerebellum . Cerebellum . Cerebral cortex. Cerebral cortex. children . aged 2–5 years . in Medicaid receiving . clinical care for . attention-deficit/hyperactivity disorder (ADHD): United States, 2011. 0.45-1.40%. 1.41-1.70%. 1.71-2.05%. 2.06-3.38%. SUPPLEMENTAL FIGURE 5. .