PPT-Using Whole Genome Sequencing for Surveillance and Outbreak
Author : min-jolicoeur | Published Date : 2019-11-21
Using Whole Genome Sequencing for Surveillance and Outbreak Investigations Minnesota Carlota Medus PhD MPH Epidemiologist Supervisor Foodborne Diseases Unit Use
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Using Whole Genome Sequencing for Survei..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Using Whole Genome Sequencing for Surveillance and Outbreak: Transcript
Using Whole Genome Sequencing for Surveillance and Outbreak Investigations Minnesota Carlota Medus PhD MPH Epidemiologist Supervisor Foodborne Diseases Unit Use of WGS for Surveillance in Minnesota. sequencing . for . identification,. detection, . and control of . Bactrocera dorsalis (. Hendel. ). and other Tephritid pests. Thomas Walk, Scott . Geib. USDA-ARS Pacific Basin Agricultural Research Center, Hilo HI. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Lenka Veselovská. Laboratory of Developmental Biology and Genomics . Next Generation Sequencing (NGS) . M. odern high-throughput DNA sequencing technologies. parallel, rapid . Decreasing price, time, workflow complexity, error rate. Timetable for today. Time. Activity. 00:00. Introduction to the session. 00:10. Story cards . 00:20. Info cards. 00:30. Issue cards. 00:40. Discuss two key. issues. 00:45. Feedback your issues. What is DNA?. Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. (very) large datasets. 5/24/18. Goals for the course. Understand how next-generation sequencing technologies are used in biomedical research. Learn how to use publicly available databases/websites to find specific information about genes. CTCA Educational Conference. March 7, 2017. Martin Cilnis, MPH, MS. Tuberculosis Control Branch . California Department of Public Health. 1. Potential Uses of Genotyping. Confirm or refute . outbreaks. TexPoint fonts used in EMF: . A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. Lecture 1. Instructor:. David Tse. dntse@stanford.edu. The Genome. …ACGTGACTGAGGACCGTG. CGACTGAGACTGACTGGGT. CTAGCTAGACTACGTTTTA. Knowing how many genes determine a phenotype (Mendelian and/or QTL analysis), and where the genes are located (linkage mapping) is a first step in understanding the genetic basis of a phenotype . A . Whole genome sequencing of babies REASONS FOR USING WHOLE GENOME SEQUENCING IN BABIES There are a number of possible reasons for carrying out whole genome or exome sequencing Seeking a diagnosis for a for a rare disease Information for patients and family members Genomic Medicine Service What is your genome? Your genome is the information needed to build the human body and keep it healthy. It for suspected cancer Information for patients and family members Genomic Medicine Service NHS What is your genome? Your genome is the information needed to build the human body and keep it health Abdul Karim Sesay . Genomics Strategic Core Platform, MRC Unit The Gambia @ LSHTM. Wellcome. Trust - Bloomsbury Centre for Global Health. Research Scientific Meeting. 17th March 2022. Genomics. DNA sequencing and the capacity to investigate the genome of host and pathogen populations have become an essential part of biomedical research, unlocking unique information about why some .
Download Document
Here is the link to download the presentation.
"Using Whole Genome Sequencing for Surveillance and Outbreak"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents