PPT-Linux + Genome Assembly

Author : smith | Published Date : 2022-06-20

Tutorial PeiChen Peng LinuxGenome Assembly Shounak Bhogale 2019 1 Step 1A Save login credential LinuxGenome Assembly Shounak Bhogale 2019 2 For viewing and manipulating

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "Linux + Genome Assembly" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

Linux + Genome Assembly: Transcript


Tutorial PeiChen Peng LinuxGenome Assembly Shounak Bhogale 2019 1 Step 1A Save login credential LinuxGenome Assembly Shounak Bhogale 2019 2 For viewing and manipulating the files needed for this laboratory exercise insert your flash drive. Stop it 57553 Arthur Dent elcome to the world of Linux the operating system developed by over a thousand people around the world In this chapter you find out about Linux itself 57553 what it is where it comes from and why it gets so much attention i sequencing . for . identification,. detection, . and control of . Bactrocera dorsalis (. Hendel. ). and other Tephritid pests. Thomas Walk, Scott . Geib. USDA-ARS Pacific Basin Agricultural Research Center, Hilo HI. Suzanna Kim. Hema Nagrajan. Deepak Purushotham. AMBILY SIVADAS. AMIT RUPANI. LEO WU. Genome Assembly . Final Results. 02 -22- 2012. Outline. Pipeline for evaluation. Quantitative evaluation. Qualitative Evaluation. From Swab to Publication. Madison I. Dunitz. 1. , David A. Coil. 1. , Jenna M. Lang. 1. , Guillaume Jospin. 1. , Aaron E. Darling. 2. , Jonathan A. Eisen. 1. UC Davis Genome Center. 1. University of California, Davis; . Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. Genome: the total number of genes in an individual.. Human Genome- approx. 20,000 genes on the 46 human chromosomes.. Human Genome Project (HGP). Ongoing effort to completely map and sequence our genome.. Purbendra yogi. Introduction. Genome assembly is the process of taking of many short DNA sequences and combine them to form original chromosome.. First generation Assembly began in the late 1980’s and early 1990’s.. Derek M Bickhart . Animal Genomics and Improvement Laboratory . Research Geneticist (Animal) . derek.bickhart@ars.usda.gov . Phone: (301) 504-8679 Fax: (301) 504-8092. USDA disclaimer. Disclaimers: Mention of trade names, commercial products, or companies in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the US Department of Agriculture over others not mentioned. . Chris Fields. Genome Assembly | Saba Ghaffari | 2020. 1. PowerPoint by Saba Ghaffari. Introduction. Exercise . Perform a bacterial genome assembly using PacBio HiFi data.. Evaluation and comparison of different datasets and parameters.. Richard Gibbs and George Weinstock man Genome Sequencing Center ) genome was sequenced in a project (12). This was the third mammalian project complex collaboration led by the BCM-HGSC (BAC skims, w kindly visit us at www.nexancourse.com. Prepare your certification exams with real time Certification Questions & Answers verified by experienced professionals! We make your certification journey easier as we provide you learning materials to help you to pass your exams from the first try. Don Johnson of BU . IS&T. We’ll start with a sign in sheet that include questions about your Linux experience and goals.. We’ll end with a class evaluation.. We’ll cover as much as we can in the time allowed, starting with the easiest and most important material. Don’t feel rushed; if we don’t cover everything, you’ll pick it up as you continue working with Linux.. assembly. Illumina. Subsample. Summarize. Assemble. Polish. Evaluate. Evaluate . unpolished. Hybrid assembly. Pacbio. . Subsample. Summarize. Assemble. Polish. Evaluate. Evaluate . polished. Parameter exploration.

Download Document

Here is the link to download the presentation.
"Linux + Genome Assembly"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents