PPT-Whole Genome Sequencing Training Activity
Author : Mermaid | Published Date : 2022-08-04
A product of the New York Integrated Food Safety Center of Excellence October 2019 Training Objective To provide public health staff or students of public health
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Whole Genome Sequencing Training Activit..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Whole Genome Sequencing Training Activity: Transcript
A product of the New York Integrated Food Safety Center of Excellence October 2019 Training Objective To provide public health staff or students of public health with an understanding of how whole genome sequencing WGS and particularly whole genome multi locus sequence typing . What is Whole Disk Encr yp tion Whole Disk Encr yp tion versus File Encr yp tion sequencing . for . identification,. detection, . and control of . Bactrocera dorsalis (. Hendel. ). and other Tephritid pests. Thomas Walk, Scott . Geib. USDA-ARS Pacific Basin Agricultural Research Center, Hilo HI. From Swab to Publication. Madison I. Dunitz. 1. , David A. Coil. 1. , Jenna M. Lang. 1. , Guillaume Jospin. 1. , Aaron E. Darling. 2. , Jonathan A. Eisen. 1. UC Davis Genome Center. 1. University of California, Davis; . Venter et. al (2004). Presented by. Ken . Vittayarukskul. Steven S. White.. Context of the Problem . Evolutionary history is directly tied to microbial genetics. Little is known. Until recently, microbial diversity was measured by PCR amplification and sequencing of only ribosomal genes. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Lenka Veselovská. Laboratory of Developmental Biology and Genomics . Next Generation Sequencing (NGS) . M. odern high-throughput DNA sequencing technologies. parallel, rapid . Decreasing price, time, workflow complexity, error rate. Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. for Colorectal . Cancer. Ulrike (. Riki. ) Peters. Fred Hutchinson Cancer Research Center. University of Washington. Overview. Significance and rationale. . Current efforts on rare and less frequent variants. (very) large datasets. 5/24/18. Goals for the course. Understand how next-generation sequencing technologies are used in biomedical research. Learn how to use publicly available databases/websites to find specific information about genes. tens of thousands of DNA bases in length. Fugu is thedraft sequenced after human. Its compact form and sim-sequence. We now have in hand the basic gene-leveldescription of two vertebrates. Compari tens of thousands of DNA bases in length Fugu is thedraft sequenced after human Its compact form and sim-sequence We now have in hand the basic gene-leveldescription of two vertebrates Comparing a Knowing how many genes determine a phenotype (Mendelian and/or QTL analysis), and where the genes are located (linkage mapping) is a first step in understanding the genetic basis of a phenotype . A . Whole genome sequencing of babies REASONS FOR USING WHOLE GENOME SEQUENCING IN BABIES There are a number of possible reasons for carrying out whole genome or exome sequencing Seeking a diagnosis for a for a rare disease Information for patients and family members Genomic Medicine Service What is your genome? Your genome is the information needed to build the human body and keep it healthy. It
Download Document
Here is the link to download the presentation.
"Whole Genome Sequencing Training Activity"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents
