PPT-Algorithms for Mitochondrial Genome Assembly and Haplogroup Assignment from Low-Coverage
Author : debby-jeon | Published Date : 2020-04-03
Fahad Alqahtani Supervisor Dr Ion Măndoiu Associate Advisors Dr Mukul Bansal amp Dr Derek Aguiar Computer Science amp Engineering Department University of Connecticut
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document " Algorithms for Mitochondrial Genome Ass..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Algorithms for Mitochondrial Genome Assembly and Haplogroup Assignment from Low-Coverage: Transcript
Fahad Alqahtani Supervisor Dr Ion Măndoiu Associate Advisors Dr Mukul Bansal amp Dr Derek Aguiar Computer Science amp Engineering Department University of Connecticut Outline Background. sequencing . for . identification,. detection, . and control of . Bactrocera dorsalis (. Hendel. ). and other Tephritid pests. Thomas Walk, Scott . Geib. USDA-ARS Pacific Basin Agricultural Research Center, Hilo HI. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . By: Dr Natasha Gerbis. Mitochondria. Mitochondria play an essential role in cellular metabolism . Convert food into energy. The “batteries” of the cell. Mitochondria. Synthesize energy molecules called ATP via oxidative phosphorylation. Disclosure: . Paid consultant for . Stealth . Biotherapeutics. David . Marcinek. Department of Radiology. University . of Washington. dmarc@. uw.edu. Muscle Study Group. Buffalo, NY. September 23, 2014. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Stephen Okoth BSN, SRNA (Sr.). York . College of PA/. Wellspan. Health NAP . Objectives. Discuss the structure of the Mitochondrion. Discuss . the main . function . of the . Mitochondrion. Detecting and Diagnosing mitochondrial diseases. Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. Session 1, day 1, Zhang. Outline. Logistic Regression. ROC curve and . AUC (area . under curve). Linear Regression. Kaplan-Meier plot and log-rank test. Cox Proportional odds model. Logistic . Model. Matthew Zimmerman, PhD. Assistant Professor. Cellular & Integrative Physiology. University of Nebraska Medical Center. mczimmerman@unmc.edu. Lecture Outline. Sources of mitochondrial-produced reactive oxygen species (ROS). VBC-608. Unit- III. P.G.. 23.11.2020. 24.11.2020. Mitochondrial Diseases. The term mitochondrial cytopathy refers to a diverse group of inherited or acquired disorders.. It is heterogeneous group of disorders.. Cerebral . Folate. Deficiency in . Autism Spectrum Disorder. Richard E. Frye, M.D., Ph.D.. Director of Autism Research . Associate Professor of Pediatrics. Arkansas Children’s Hospital. The Rise in Autism. Mitochondrial DNA Mitochondrial DNA (mtDNA) is DNA contained in the mitochondria in our cells - these are the energy - generating structures commonly referred to as the 'batteries' or 'powerhouses' G-OnRamp Beta Users Workshop. Wilson Leung. 07/2016. Outline. Obtain genome assemblies from NCBI. Transfer . large genomics datasets to Galaxy. Common bioinformatics file formats . D. atatypes in Galaxy. Dr. Sonalika’s Eye Clinic provide the best Low vision aids treatment in Pune, Hadapsar, Amanora, Magarpatta, Mundhwa, Kharadi Rd, Viman Nagar, Wagholi, and Wadgaon Sheri
Download Document
Here is the link to download the presentation.
" Algorithms for Mitochondrial Genome Assembly and Haplogroup Assignment from Low-Coverage"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents
