PPT-Barley Fields Primary School

Maths Workshop November 2015 Aims of the session To explore the New Maths Curriculum To model the use of methods and strategies To give you a greater understanding of the progression in Maths from Year 1 Year 3. S Barley is the worlds oldest grain as evidenced by discoveries in ancient cities in the Mideast and North Africa It has been cultivate d for about 8000 years and today is the worlds fourth largest cereal crop Ba rley as a food is most commonly ident Patrick Hayes. Dept. Crop and Soil Science. Oregon State University. Corvallis, Oregon USA. www.barleyworld.org. What barley was. What barley is. What barley could be . First crop domesticated (?) . Beer . . Crop. LIFE12 ENV/IT/000356. 01/01/2014-31/12/2015. Barley. . Crop. Photo. 1. . Barley. . crop. 30/03/2015. Barley. . Crop. Photo. 2. . Barley. . crop. 30/03/2015. Barley. . Crop. Photo. Global and local considerations. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). . Play - Welcome. GDRHS Fields Renovation Project. GDRSD School Committee . Aprroval. Presentation. 29. . November 2016 . GDatPlay.net. Welcome. 2. Welcome. 3. GD AT. . Play - Welcome. Global and local considerations. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). http://www.lincfoods.com/malt. /. http://www.meccagrade.com. /. http://. barleyworld.org/malt-house. Barley contributes to beer flavor. The Flavor 7-Pack. Bells, Deschutes, Firestone-Walker New Glarus, . Taketa PNAS 2008. Hulled phenotype controlled by one gene: NUD. >NUD_CDS. ATGGTACAGTCCAAGAAGAAGTTTCGCGGCGTCAGGCAGCGCCACTGGGGCTCCTGGGTCTCCGAGATCAGGCATCCTCTCCTAAGAGGAGGGTGTGGTTGGGCACCTTTGAGACGGCGGAGGAGGCTGCGCGGGCGTACGATGAGGCTGCCATCCTGATGAGCGGGCGCAACGCCAAGACCAACTTCCCCGTACCGAGGAGTGCCAACGGGGAGATCATCGTCGCCCCAGCAGCAGCAGCACGGGACATTCGCGGTGGCGTTGGCTCGTCGTCCTCCGGGGCCGCCGGCGCCAGCAGCCTGTCACAGATCCTCAGCGCCAAGCTCCGCAAGTGCTGCAAGACACCGTCCCCGTCCCTCACCTGCCTCCGCCTCGACACCGAGAAGTCCCACATTGGCGTCTGGCAGAAGCGCGCGGGTGCCCGTGCCGACTCCAGCTGGGTCATGACCGTCGAGCTCAACAAGGAGCCGGCCGCAGCGGCACCACCAACGCCCAGCGACAGCACGGTGTCGGCGACTCCTTCCTCGTCCACGTCCACGTCCACAACGGGCTCCCCACCGGAGGCAATGGAGGACGAAGAGAGGATCGCGCTGCAGATGATAGAGGAGCTGCTGAGCAGGAGCAGCCCGGCTTCGCCGTCACATGGGCTGCTGCACGGTGAAGAAGGCAGCCTCCTCATCTGA. :. farming barley in . the UK. ;. the process of malting;. barley . in our . diet;. f. ood and drink made from barley and malt.. Farming barley. Barley is grown on about 1.2 million hectares of land in the UK. . 5.3 . Gbp. . ~ 30,000 genes. Self-pollinated (hermaphroditic). Inflorescence type. 2-row vs. 6-row. 1 gene/30,000 genes. . Covered vs. Naked . 1 gene/30,000 genes. Growth Habit. Winter, facultative and spring. Toy Catalogue. July 2012. July 2012. NPS-K2. Mega Blocks - Sonny School Bus – Yellow. Contains - Bus, Driver, 2 blue blocks, 1 red block. Ages -1-5. NPS-K2. Naidovi. Primary School – Kindergarten. July, 2012. Barley is a member of the . Gramineae. family.. In Ireland Barley is grown in two forms. Feeding barley is used as an animal feed.. Malting barley is used for malting and brewing alcohol.. Barley is easily distinguished from other cereals by the awns present on the grain. Primary School. Site Plan. Roslin. Primary School. Playground Plan. Roslin. Primary School. Playground Sections. Roslin. Primary School. Ground Floor Plan. Roslin. Primary School. Elevations. Roslin. Why (Barley). How (Malting). Who (Barley Research, Production and Processing). What’s next (naked barley). Random bits of science and technology. Tap Talk # 1 . Why (Barley). In the beginning there was spontaneity: .